\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703793591:

Variant ID: vg0703793591 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3793591
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTTCGCTAGCGGTACTAAAGAGCACCAACACCAGTGAAAAAATTCACAGCCATTATAAAAATCACCATCCAACGGCCAGTAGTACTTATCCATCCAT[C/G]
CTCATCAACCAGCCTCTCCTCTCCTCTACCCCCACCAGCACTCTCTCCTCCTCCCACCCCACAGTCGGCGGTGGTGGCTCCGGCGTGGTGACAACGATGG

Reverse complement sequence

CCATCGTTGTCACCACGCCGGAGCCACCACCGCCGACTGTGGGGTGGGAGGAGGAGAGAGTGCTGGTGGGGGTAGAGGAGAGGAGAGGCTGGTTGATGAG[G/C]
ATGGATGGATAAGTACTACTGGCCGTTGGATGGTGATTTTTATAATGGCTGTGAATTTTTTCACTGGTGTTGGTGCTCTTTAGTACCGCTAGCGAAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 20.20% 1.31% 0.00% NA
All Indica  2759 94.40% 4.70% 0.83% 0.00% NA
All Japonica  1512 62.10% 35.80% 2.05% 0.00% NA
Aus  269 2.60% 95.50% 1.86% 0.00% NA
Indica I  595 91.80% 6.60% 1.68% 0.00% NA
Indica II  465 95.90% 3.00% 1.08% 0.00% NA
Indica III  913 98.10% 1.60% 0.22% 0.00% NA
Indica Intermediate  786 91.20% 8.00% 0.76% 0.00% NA
Temperate Japonica  767 39.90% 56.50% 3.65% 0.00% NA
Tropical Japonica  504 91.50% 8.30% 0.20% 0.00% NA
Japonica Intermediate  241 71.40% 27.80% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703793591 C -> G LOC_Os07g07580.3 upstream_gene_variant ; 3719.0bp to feature; MODIFIER silent_mutation Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0703793591 C -> G LOC_Os07g07580.1 upstream_gene_variant ; 3719.0bp to feature; MODIFIER silent_mutation Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0703793591 C -> G LOC_Os07g07580.2 upstream_gene_variant ; 3719.0bp to feature; MODIFIER silent_mutation Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0703793591 C -> G LOC_Os07g07570-LOC_Os07g07580 intergenic_region ; MODIFIER silent_mutation Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703793591 NA 3.79E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 1.88E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 4.46E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 8.96E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 1.11E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 9.71E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 3.17E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 1.24E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 7.09E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 6.80E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 9.78E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 1.72E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 4.86E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 1.04E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 2.95E-06 2.94E-06 mr1814 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 3.76E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 5.30E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 6.48E-06 NA mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703793591 NA 2.92E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251