\
| Variant ID: vg0703793591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3793591 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATTTTCGCTAGCGGTACTAAAGAGCACCAACACCAGTGAAAAAATTCACAGCCATTATAAAAATCACCATCCAACGGCCAGTAGTACTTATCCATCCAT[C/G]
CTCATCAACCAGCCTCTCCTCTCCTCTACCCCCACCAGCACTCTCTCCTCCTCCCACCCCACAGTCGGCGGTGGTGGCTCCGGCGTGGTGACAACGATGG
CCATCGTTGTCACCACGCCGGAGCCACCACCGCCGACTGTGGGGTGGGAGGAGGAGAGAGTGCTGGTGGGGGTAGAGGAGAGGAGAGGCTGGTTGATGAG[G/C]
ATGGATGGATAAGTACTACTGGCCGTTGGATGGTGATTTTTATAATGGCTGTGAATTTTTTCACTGGTGTTGGTGCTCTTTAGTACCGCTAGCGAAAATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 20.20% | 1.31% | 0.00% | NA |
| All Indica | 2759 | 94.40% | 4.70% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 62.10% | 35.80% | 2.05% | 0.00% | NA |
| Aus | 269 | 2.60% | 95.50% | 1.86% | 0.00% | NA |
| Indica I | 595 | 91.80% | 6.60% | 1.68% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 39.90% | 56.50% | 3.65% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 8.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 27.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703793591 | C -> G | LOC_Os07g07580.3 | upstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0703793591 | C -> G | LOC_Os07g07580.1 | upstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0703793591 | C -> G | LOC_Os07g07580.2 | upstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0703793591 | C -> G | LOC_Os07g07570-LOC_Os07g07580 | intergenic_region ; MODIFIER | silent_mutation | Average:68.966; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703793591 | NA | 3.79E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 1.88E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 4.46E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 8.96E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 1.11E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 9.71E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 3.17E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 1.24E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 7.09E-08 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 6.80E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 9.78E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 1.72E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 4.86E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 1.04E-09 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | 2.95E-06 | 2.94E-06 | mr1814 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 3.76E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 5.30E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | 6.48E-06 | NA | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703793591 | NA | 2.92E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |