\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703703405:

Variant ID: vg0703703405 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3703405
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGCTAAATACAAACAATACTGCTTACATTCATCGAAACATTTTACTTAAAAGTTTATTTTGATCAAAGATTAACACTGGTCAACAATGTCAAATAAAA[A/T]
TAAAAAGGAACTATTTTGCAGTATAAGAAAGCCAGGTTCAGTAATCCACATGGTATAACAGGGTAGCTTATCACTGTTTTAGTCATATTAATTATTATAT

Reverse complement sequence

ATATAATAATTAATATGACTAAAACAGTGATAAGCTACCCTGTTATACCATGTGGATTACTGAACCTGGCTTTCTTATACTGCAAAATAGTTCCTTTTTA[T/A]
TTTTATTTGACATTGTTGACCAGTGTTAATCTTTGATCAAAATAAACTTTTAAGTAAAATGTTTCGATGAATGTAAGCAGTATTGTTTGTATTTAGCATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 4.00% 0.15% 0.00% NA
All Indica  2759 98.60% 1.30% 0.11% 0.00% NA
All Japonica  1512 95.50% 4.40% 0.13% 0.00% NA
Aus  269 71.00% 28.30% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.50% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 88.30% 11.30% 0.40% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703703405 A -> T LOC_Os07g07400.1 upstream_gene_variant ; 4277.0bp to feature; MODIFIER silent_mutation Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0703703405 A -> T LOC_Os07g07410.1 downstream_gene_variant ; 1845.0bp to feature; MODIFIER silent_mutation Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0703703405 A -> T LOC_Os07g07430.1 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0703703405 A -> T LOC_Os07g07410.2 downstream_gene_variant ; 1825.0bp to feature; MODIFIER silent_mutation Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N
vg0703703405 A -> T LOC_Os07g07420.1 intron_variant ; MODIFIER silent_mutation Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703703405 NA 1.65E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703703405 NA 1.31E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703703405 NA 1.53E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703703405 4.75E-06 4.75E-06 mr1649_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251