\
| Variant ID: vg0703703405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3703405 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATGCTAAATACAAACAATACTGCTTACATTCATCGAAACATTTTACTTAAAAGTTTATTTTGATCAAAGATTAACACTGGTCAACAATGTCAAATAAAA[A/T]
TAAAAAGGAACTATTTTGCAGTATAAGAAAGCCAGGTTCAGTAATCCACATGGTATAACAGGGTAGCTTATCACTGTTTTAGTCATATTAATTATTATAT
ATATAATAATTAATATGACTAAAACAGTGATAAGCTACCCTGTTATACCATGTGGATTACTGAACCTGGCTTTCTTATACTGCAAAATAGTTCCTTTTTA[T/A]
TTTTATTTGACATTGTTGACCAGTGTTAATCTTTGATCAAAATAAACTTTTAAGTAAAATGTTTCGATGAATGTAAGCAGTATTGTTTGTATTTAGCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 4.00% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 95.50% | 4.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 71.00% | 28.30% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 88.30% | 11.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703703405 | A -> T | LOC_Os07g07400.1 | upstream_gene_variant ; 4277.0bp to feature; MODIFIER | silent_mutation | Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0703703405 | A -> T | LOC_Os07g07410.1 | downstream_gene_variant ; 1845.0bp to feature; MODIFIER | silent_mutation | Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0703703405 | A -> T | LOC_Os07g07430.1 | downstream_gene_variant ; 3402.0bp to feature; MODIFIER | silent_mutation | Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0703703405 | A -> T | LOC_Os07g07410.2 | downstream_gene_variant ; 1825.0bp to feature; MODIFIER | silent_mutation | Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0703703405 | A -> T | LOC_Os07g07420.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.442; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703703405 | NA | 1.65E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703703405 | NA | 1.31E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703703405 | NA | 1.53E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703703405 | 4.75E-06 | 4.75E-06 | mr1649_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |