\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703689998:

Variant ID: vg0703689998 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3689998
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, T: 0.31, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGGACTATAATAACCGGGAATAAAGATAAAAAAATTCCTCAGAGCTTTCAAACCGGAACTAAAGATGTTTTTAGTCCCGGTTTTTAATACAACCGGG[T/A]
CTATTGTGAAATCTGGTGGACCGACCAAAGATGGTTTCTCCACCAGTGATGGTAGTATAAAATTTAGAAGAAAAAGTAAACTAGAAGTGAGATAACATGT

Reverse complement sequence

ACATGTTATCTCACTTCTAGTTTACTTTTTCTTCTAAATTTTATACTACCATCACTGGTGGAGAAACCATCTTTGGTCGGTCCACCAGATTTCACAATAG[A/T]
CCCGGTTGTATTAAAAACCGGGACTAAAAACATCTTTAGTTCCGGTTTGAAAGCTCTGAGGAATTTTTTTATCTTTATTCCCGGTTATTATAGTCCCGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.10% 0.02% 0.00% NA
All Indica  2759 95.10% 4.90% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 93.60% 6.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703689998 T -> A LOC_Os07g07370.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:70.788; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0703689998 T -> A LOC_Os07g07390.1 upstream_gene_variant ; 169.0bp to feature; MODIFIER silent_mutation Average:70.788; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0703689998 T -> A LOC_Os07g07380.1 downstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:70.788; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0703689998 T -> A LOC_Os07g07380-LOC_Os07g07390 intergenic_region ; MODIFIER silent_mutation Average:70.788; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703689998 NA 1.05E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 1.07E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 1.79E-23 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 7.10E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 2.26E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 5.39E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 7.86E-07 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 7.86E-07 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 4.81E-08 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 3.25E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 1.20E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 1.58E-06 9.10E-07 mr1631 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 7.56E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 9.58E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 8.32E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703689998 NA 1.87E-11 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251