Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0703681415:

Variant ID: vg0703681415 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3681415
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGGCCCCGCATTTGGGCGGGGAGGGGATGGGGGACAGATTTCACCCGCGGGTGACCCGCGGGGCCCCGGGGGGTACATATAGACCTCAAAATATAGAT[C/G]
AAAGAAAGCCCAAAAGGCCCAACCCACTGAAGACGTTCCTTAACCCTAGCACATGCACATCCCCTCAGTCTCTATCCTCCCCACATCGATTCCCCTCCCC

Reverse complement sequence

GGGGAGGGGAATCGATGTGGGGAGGATAGAGACTGAGGGGATGTGCATGTGCTAGGGTTAAGGAACGTCTTCAGTGGGTTGGGCCTTTTGGGCTTTCTTT[G/C]
ATCTATATTTTGAGGTCTATATGTACCCCCCGGGGCCCCGCGGGTCACCCGCGGGTGAAATCTGTCCCCCATCCCCTCCCCGCCCAAATGCGGGGCCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.20% 0.36% 0.00% NA
All Indica  2759 91.60% 7.90% 0.43% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 6.70% 91.80% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.90% 6.50% 0.65% 0.00% NA
Indica III  913 87.40% 12.30% 0.33% 0.00% NA
Indica Intermediate  786 89.40% 9.80% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703681415 C -> G LOC_Os07g07350.1 upstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0703681415 C -> G LOC_Os07g07360.1 upstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0703681415 C -> G LOC_Os07g07350.2 upstream_gene_variant ; 4648.0bp to feature; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0703681415 C -> G LOC_Os07g07350.3 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0703681415 C -> G LOC_Os07g07370.1 downstream_gene_variant ; 4036.0bp to feature; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N
vg0703681415 C -> G LOC_Os07g07350-LOC_Os07g07360 intergenic_region ; MODIFIER silent_mutation Average:83.926; most accessible tissue: Zhenshan97 panicle, score: 93.752 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0703681415 C G 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703681415 NA 8.94E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 1.06E-25 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 6.49E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 1.49E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 7.44E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 8.68E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 9.91E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 1.82E-21 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703681415 NA 7.35E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251