\
| Variant ID: vg0702977077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2977077 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
CCATCCATGATTGGTAAACAGTTGCATAACCGTCGTTTCAAGCTTACGACATGCAACAATTAGGAAATCTCCATCTTCATCACATTTTTATAACTGTGCC[C/T]
ATAGACGAAGCAAATATGTTGCCTTGAAAATGACCTACATATAAGTAACTGTAGGTGATTTGTCAAAACCCTATCATTCCTACTCAACCATAAAGCCCAA
TTGGGCTTTATGGTTGAGTAGGAATGATAGGGTTTTGACAAATCACCTACAGTTACTTATATGTAGGTCATTTTCAAGGCAACATATTTGCTTCGTCTAT[G/A]
GGCACAGTTATAAAAATGTGATGAAGATGGAGATTTCCTAATTGTTGCATGTCGTAAGCTTGAAACGACGGTTATGCAACTGTTTACCAATCATGGATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.30% | 30.00% | 2.71% | 0.00% | NA |
| All Indica | 2759 | 60.30% | 36.90% | 2.72% | 0.00% | NA |
| All Japonica | 1512 | 79.00% | 17.90% | 3.11% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 71.80% | 23.90% | 4.37% | 0.00% | NA |
| Indica II | 465 | 73.80% | 23.40% | 2.80% | 0.00% | NA |
| Indica III | 913 | 45.80% | 53.60% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 60.70% | 35.50% | 3.82% | 0.00% | NA |
| Temperate Japonica | 767 | 81.10% | 14.10% | 4.82% | 0.00% | NA |
| Tropical Japonica | 504 | 70.80% | 28.00% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 8.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 86.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 24.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702977077 | C -> T | LOC_Os07g06120-LOC_Os07g06130 | intergenic_region ; MODIFIER | silent_mutation | Average:54.059; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702977077 | 1.63E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | 2.09E-06 | NA | mr1139 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 5.06E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 7.91E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 9.09E-06 | mr1400_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 3.72E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 5.07E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702977077 | NA | 5.76E-06 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |