RiceVarMap2

Detailed information for vg0702907786:

Variant ID: vg0702907786 (JBrowse)

Variation Type: SNP

Chromosome: chr07

Position: 2907786

Reference Allele: A

Alternative Allele: G

Primary Allele: A

Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.02, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTGATCAGTCTATTGTCACGACCGGAAATAACCCAACGGGCATTCCTTACGTGCGTGCATTAATCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTG[A/G]
TACAATTCAGAGTTTAACAAGCGGAAGCATAATTAGATAACTTAATACATGGGCTACGAAGGCCCAGCACACACAGAGACAAACGAGAAACAGCGGAAGA

Reverse complement sequence

TCTTCCGCTGTTTCTCGTTTGTCTCTGTGTGTGCTGGGCCTTCGTAGCCCATGTATTAAGTTATCTAATTATGCTTCCGCTTGTTAAACTCTGAATTGTA[T/C]
CAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGATTAATGCACGCACGTAAGGAATGCCCGTTGGGTTATTTCCGGTCGTGACAATAGACTGATCAAGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	26.80%	1.88%	0.00%	NA
All Indica	2759	60.50%	37.10%	2.39%	0.00%	NA
All Japonica	1512	87.20%	11.80%	0.99%	0.00%	NA
Aus	269	85.50%	13.40%	1.12%	0.00%	NA
Indica I	595	62.90%	32.10%	5.04%	0.00%	NA
Indica II	465	43.70%	54.40%	1.94%	0.00%	NA
Indica III	913	69.10%	29.80%	1.10%	0.00%	NA
Indica Intermediate	786	58.70%	39.20%	2.16%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	71.00%	27.00%	1.98%	0.00%	NA
Japonica Intermediate	241	82.20%	16.20%	1.66%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	68.90%	25.60%	5.56%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702907786	A -> G	LOC_Os07g06000.1	downstream_gene_variant ; 2882.0bp to feature; MODIFIER	silent_mutation	Average:35.609; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0702907786	A -> G	LOC_Os07g06020.1	downstream_gene_variant ; 3072.0bp to feature; MODIFIER	silent_mutation	Average:35.609; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0702907786	A -> G	LOC_Os07g06010.1	intron_variant ; MODIFIER	silent_mutation	Average:35.609; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702907786	5.83E-06	9.17E-08	mr1272	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0702907786:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact