\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702836416:

Variant ID: vg0702836416 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2836416
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTCTTTCTTTCACGTAACCAAATTTACTTGCATGACAACGAAGAGAGTCCGTTATTAAACACAATTGTACATGCCCTAACGCAGTTAATTAGTTTT[T/C]
GTCGAAGAATCAGGGACGCTGAGGTAGGTAGTTACATGCATGTAGGCCAAGTTAGTCGCTGTCCGTAGAATAATGGCGTTGATATATAGTAACCCTGAAT

Reverse complement sequence

ATTCAGGGTTACTATATATCAACGCCATTATTCTACGGACAGCGACTAACTTGGCCTACATGCATGTAACTACCTACCTCAGCGTCCCTGATTCTTCGAC[A/G]
AAAACTAATTAACTGCGTTAGGGCATGTACAATTGTGTTTAATAACGGACTCTCTTCGTTGTCATGCAAGTAAATTTGGTTACGTGAAAGAAAGAGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 42.00% 0.51% 0.00% NA
All Indica  2759 37.30% 62.10% 0.69% 0.00% NA
All Japonica  1512 90.90% 8.90% 0.20% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 42.00% 57.50% 0.50% 0.00% NA
Indica II  465 19.60% 80.00% 0.43% 0.00% NA
Indica III  913 45.60% 53.70% 0.77% 0.00% NA
Indica Intermediate  786 34.50% 64.60% 0.89% 0.00% NA
Temperate Japonica  767 97.90% 1.80% 0.26% 0.00% NA
Tropical Japonica  504 78.60% 21.40% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.00% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702836416 T -> C LOC_Os07g05900.1 downstream_gene_variant ; 3060.0bp to feature; MODIFIER silent_mutation Average:61.86; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0702836416 T -> C LOC_Os07g05890-LOC_Os07g05900 intergenic_region ; MODIFIER silent_mutation Average:61.86; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702836416 NA 4.96E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 8.38E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 3.02E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 1.72E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 1.29E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 1.46E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 1.11E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 1.70E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 5.15E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 4.62E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 7.50E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 7.97E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 4.01E-06 3.22E-06 mr1010_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 2.84E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 5.58E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702836416 NA 2.55E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251