Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702696812:

Variant ID: vg0702696812 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2696812
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.44, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTATAGCCCACTACTAGCTCCAAATCATCTATAGCTAATGTAATAGCCAATTCTTACAATAGTTGCTTACTATACTATTAATACCTAGTCCCACCTGT[T/C]
ATACACACATTACGTCTTGGAGTCCGTGCTGCAGCTAGCTACAGATCTGTAGCCCGCTGCTCTTCTCTCTCTTCCTTTATCTCTTTAAAATATGTTTATA

Reverse complement sequence

TATAAACATATTTTAAAGAGATAAAGGAAGAGAGAGAAGAGCAGCGGGCTACAGATCTGTAGCTAGCTGCAGCACGGACTCCAAGACGTAATGTGTGTAT[A/G]
ACAGGTGGGACTAGGTATTAATAGTATAGTAAGCAACTATTGTAAGAATTGGCTATTACATTAGCTATAGATGATTTGGAGCTAGTAGTGGGCTATACTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.60%	45.30%	0.06%	0.00%	NA
All Indica	2759	24.60%	75.30%	0.11%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	25.70%	74.10%	0.17%	0.00%	NA
Indica II	465	12.30%	87.30%	0.43%	0.00%	NA
Indica III	913	29.90%	70.10%	0.00%	0.00%	NA
Indica Intermediate	786	24.90%	75.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702696812	T -> C	LOC_Os07g05650.1	downstream_gene_variant ; 3723.0bp to feature; MODIFIER	silent_mutation	Average:48.017; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0702696812	T -> C	LOC_Os07g05660.1	intron_variant ; MODIFIER	silent_mutation	Average:48.017; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702696812	NA	4.60E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	9.50E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	7.68E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	2.06E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	8.22E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	2.85E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	6.99E-16	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	2.27E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	2.41E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	3.10E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	6.99E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	7.08E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	9.34E-06	mr1811_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702696812	NA	3.88E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251