\
| Variant ID: vg0702672533 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2672533 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCATGCATGCAACCATGCAAGGCACCAGCTACCTTTTATTTTGGCATGCATTTCATTACTACGCCATGCAATTAACCCAGAGAGACAGCGTCTCAACTAG[C/T]
AACATACTCTCTCCGTCTCAAAATATAAGATATTTTAGTTGGATGTGACATTCTTAGTACTCCCTCCATCCACAAAAGTTAGACATATTTCACATTTGAG
CTCAAATGTGAAATATGTCTAACTTTTGTGGATGGAGGGAGTACTAAGAATGTCACATCCAACTAAAATATCTTATATTTTGAGACGGAGAGAGTATGTT[G/A]
CTAGTTGAGACGCTGTCTCTCTGGGTTAATTGCATGGCGTAGTAATGAAATGCATGCCAAAATAAAAGGTAGCTGGTGCCTTGCATGGTTGCATGCATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 4.30% | 1.67% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 81.80% | 13.40% | 4.76% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 65.10% | 26.30% | 8.60% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702672533 | C -> T | LOC_Os07g05620-LOC_Os07g05630 | intergenic_region ; MODIFIER | silent_mutation | Average:43.15; most accessible tissue: Zhenshan97 flower, score: 64.723 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702672533 | 3.39E-06 | NA | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 2.14E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | 3.21E-06 | NA | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | 2.38E-06 | NA | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 3.30E-07 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 2.46E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 8.38E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | 5.46E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 2.10E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 5.15E-06 | mr1296_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 1.92E-06 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | 2.63E-06 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 2.97E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702672533 | NA | 8.69E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |