\
| Variant ID: vg0702624412 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2624412 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATCTGCAGTACGTGGCATGCATTACATATATTTAAATATGTTAATTAATTCGATCTGGATTAATCAAAATTAACATATCTCTATCTCTACTACTTAAAA[C/A]
ATAAGAGGTGCTTCCATTGTCCGTCAAAAAAATCGGGCGAAAAAAACCAAATTTATCCGATCTAAAAAACTGAGCGAAAGAAAACGTCCAGAAAAAAGAG
CTCTTTTTTCTGGACGTTTTCTTTCGCTCAGTTTTTTAGATCGGATAAATTTGGTTTTTTTCGCCCGATTTTTTTGACGGACAATGGAAGCACCTCTTAT[G/T]
TTTTAAGTAGTAGAGATAGAGATATGTTAATTTTGATTAATCCAGATCGAATTAATTAACATATTTAAATATATGTAATGCATGCCACGTACTGCAGATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 10.30% | 3.09% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 0.80% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 61.40% | 30.30% | 8.33% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 2.70% | 1.51% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 39.60% | 47.20% | 13.17% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 3.20% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 33.20% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 6.70% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702624412 | C -> A | LOC_Os07g05600.1 | upstream_gene_variant ; 3941.0bp to feature; MODIFIER | silent_mutation | Average:29.358; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0702624412 | C -> A | LOC_Os07g05590.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.358; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702624412 | NA | 1.44E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 8.92E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | 1.71E-06 | 2.39E-07 | mr1596 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | 6.43E-06 | 7.02E-08 | mr1596 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 1.24E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 5.92E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 9.81E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | 4.46E-06 | NA | mr1789 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 3.23E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 7.63E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 8.08E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 1.46E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702624412 | NA | 4.23E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |