\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702609879:

Variant ID: vg0702609879 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2609879
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAGCCACGAGTTTTGCACATCCATATGATTAATATGTTAACAGATTTTTTATTTGGCATTTCCAATTAACTTGTCAACTCAAACTCCTAGCTTGCAT[C/T]
AATATACGATGGATATTTCAGTGTCAAAGTGGACAAGTCAACTTTGTAATCTCGACGCAAGGCCGTACGGTAGCATCTGTGAGGTGTGCGACTGTTTAGT

Reverse complement sequence

ACTAAACAGTCGCACACCTCACAGATGCTACCGTACGGCCTTGCGTCGAGATTACAAAGTTGACTTGTCCACTTTGACACTGAAATATCCATCGTATATT[G/A]
ATGCAAGCTAGGAGTTTGAGTTGACAAGTTAATTGGAAATGCCAAATAAAAAATCTGTTAACATATTAATCATATGGATGTGCAAAACTCGTGGCTTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 38.50% 0.19% 0.36% NA
All Indica  2759 92.10% 7.20% 0.22% 0.40% NA
All Japonica  1512 0.90% 98.90% 0.00% 0.20% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 80.80% 18.50% 0.34% 0.34% NA
Indica II  465 96.60% 3.00% 0.22% 0.22% NA
Indica III  913 96.80% 3.00% 0.11% 0.11% NA
Indica Intermediate  786 92.60% 6.20% 0.25% 0.89% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.00% 0.00% 0.40% NA
Japonica Intermediate  241 0.00% 99.60% 0.00% 0.41% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 38.90% 55.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702609879 C -> DEL N N silent_mutation Average:82.395; most accessible tissue: Minghui63 root, score: 94.438 N N N N
vg0702609879 C -> T LOC_Os07g05570.1 upstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:82.395; most accessible tissue: Minghui63 root, score: 94.438 N N N N
vg0702609879 C -> T LOC_Os07g05580.1 upstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:82.395; most accessible tissue: Minghui63 root, score: 94.438 N N N N
vg0702609879 C -> T LOC_Os07g05570.2 upstream_gene_variant ; 3654.0bp to feature; MODIFIER silent_mutation Average:82.395; most accessible tissue: Minghui63 root, score: 94.438 N N N N
vg0702609879 C -> T LOC_Os07g05570-LOC_Os07g05580 intergenic_region ; MODIFIER silent_mutation Average:82.395; most accessible tissue: Minghui63 root, score: 94.438 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0702609879 C T 0.23 0.09 0.07 0.01 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702609879 NA 3.60E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 1.34E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 7.49E-06 NA mr1558 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 1.00E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 5.39E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 1.70E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 6.28E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 8.09E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 3.82E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 9.46E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 8.93E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 7.89E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 9.41E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 4.29E-06 2.23E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 9.97E-07 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 2.69E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 1.33E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 8.18E-25 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 2.83E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702609879 NA 2.43E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251