\
| Variant ID: vg0702586803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2586803 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 94. )
TTCAATTCACCCATCATGGACATCTCAAAACGTTTGGTCATCAACCTACTAAACTCTTCACTAAAAGACTTGTTAGTAGAACCAAATATAATGTCATCGA[T/C]
ATATATTTGGCACACAAAAATATCATTATCATGTCTTTTAGTAAAAAGAGTTGAATCGGCTTTCCCGATTTCAAAGCCGTTTTTCACAAGAAAATTTCGG
CCGAAATTTTCTTGTGAAAAACGGCTTTGAAATCGGGAAAGCCGATTCAACTCTTTTTACTAAAAGACATGATAATGATATTTTTGTGTGCCAAATATAT[A/G]
TCGATGACATTATATTTGGTTCTACTAACAAGTCTTTTAGTGAAGAGTTTAGTAGGTTGATGACCAAACGTTTTGAGATGTCCATGATGGGTGAATTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 39.90% | 9.80% | 0.00% | NA |
| All Indica | 2759 | 74.70% | 9.40% | 15.88% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 91.10% | 2.60% | 6.32% | 0.00% | NA |
| Indica I | 595 | 72.60% | 16.10% | 11.26% | 0.00% | NA |
| Indica II | 465 | 77.60% | 6.20% | 16.13% | 0.00% | NA |
| Indica III | 913 | 75.40% | 7.90% | 16.76% | 0.00% | NA |
| Indica Intermediate | 786 | 73.90% | 7.90% | 18.19% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 60.00% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702586803 | T -> C | LOC_Os07g05540.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.045; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702586803 | NA | 2.58E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 4.29E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | 5.13E-06 | 5.13E-06 | mr1339 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | 5.72E-06 | 5.72E-06 | mr1398 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 8.58E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 2.63E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 7.51E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | 5.01E-07 | 5.00E-07 | mr1551 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 2.63E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 7.74E-08 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 5.67E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 1.25E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 4.24E-33 | mr1733 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 3.36E-07 | mr1733 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 6.47E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 8.29E-06 | mr1783 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 4.02E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 4.83E-06 | mr1804 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | 4.05E-07 | 4.05E-07 | mr1834 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | 3.16E-06 | 3.16E-06 | mr1978 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 2.57E-17 | mr1281_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702586803 | NA | 8.99E-23 | mr1708_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |