\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702586803:

Variant ID: vg0702586803 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2586803
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAATTCACCCATCATGGACATCTCAAAACGTTTGGTCATCAACCTACTAAACTCTTCACTAAAAGACTTGTTAGTAGAACCAAATATAATGTCATCGA[T/C]
ATATATTTGGCACACAAAAATATCATTATCATGTCTTTTAGTAAAAAGAGTTGAATCGGCTTTCCCGATTTCAAAGCCGTTTTTCACAAGAAAATTTCGG

Reverse complement sequence

CCGAAATTTTCTTGTGAAAAACGGCTTTGAAATCGGGAAAGCCGATTCAACTCTTTTTACTAAAAGACATGATAATGATATTTTTGTGTGCCAAATATAT[A/G]
TCGATGACATTATATTTGGTTCTACTAACAAGTCTTTTAGTGAAGAGTTTAGTAGGTTGATGACCAAACGTTTTGAGATGTCCATGATGGGTGAATTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 39.90% 9.80% 0.00% NA
All Indica  2759 74.70% 9.40% 15.88% 0.00% NA
All Japonica  1512 0.70% 99.10% 0.13% 0.00% NA
Aus  269 91.10% 2.60% 6.32% 0.00% NA
Indica I  595 72.60% 16.10% 11.26% 0.00% NA
Indica II  465 77.60% 6.20% 16.13% 0.00% NA
Indica III  913 75.40% 7.90% 16.76% 0.00% NA
Indica Intermediate  786 73.90% 7.90% 18.19% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.40% 0.40% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 71.90% 3.12% 0.00% NA
Intermediate  90 36.70% 60.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702586803 T -> C LOC_Os07g05540.1 intron_variant ; MODIFIER silent_mutation Average:24.045; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702586803 NA 2.58E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 4.29E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 5.13E-06 5.13E-06 mr1339 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 5.72E-06 5.72E-06 mr1398 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 8.58E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 2.63E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 7.51E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 5.01E-07 5.00E-07 mr1551 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 2.63E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 7.74E-08 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 5.67E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 1.25E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 4.24E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 3.36E-07 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 6.47E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 8.29E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 4.02E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 4.83E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 4.05E-07 4.05E-07 mr1834 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 3.16E-06 3.16E-06 mr1978 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 2.57E-17 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702586803 NA 8.99E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251