\
| Variant ID: vg0702575490 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2575490 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGGCTCCTAATCCATCAAAACCCCCGGACCAAATAAGCCCTAATCCTAATTCCAGTTTTCCCCTTCCTCCCCTCCACGCAGGCCGCCTCTCTCCCCACC[G/A]
GCGCACCTCTTCGTGCCCCTCCCCACCGGCGGTGCCCAACGGATGGCGACGGTAGCAGCCTTCCCCACCGAGCAGCGGCAGTGGTGACGGCAACCTTCTC
GAGAAGGTTGCCGTCACCACTGCCGCTGCTCGGTGGGGAAGGCTGCTACCGTCGCCATCCGTTGGGCACCGCCGGTGGGGAGGGGCACGAAGAGGTGCGC[C/T]
GGTGGGGAGAGAGGCGGCCTGCGTGGAGGGGAGGAAGGGGAAAACTGGAATTAGGATTAGGGCTTATTTGGTCCGGGGGTTTTGATGGATTAGGAGCCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.50% | 0.90% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.70% | 2.60% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 88.30% | 7.10% | 4.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702575490 | G -> A | LOC_Os07g05510.1 | upstream_gene_variant ; 4849.0bp to feature; MODIFIER | silent_mutation | Average:72.103; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0702575490 | G -> A | LOC_Os07g05530.1 | upstream_gene_variant ; 4727.0bp to feature; MODIFIER | silent_mutation | Average:72.103; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0702575490 | G -> A | LOC_Os07g05520.1 | downstream_gene_variant ; 704.0bp to feature; MODIFIER | silent_mutation | Average:72.103; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| vg0702575490 | G -> A | LOC_Os07g05510-LOC_Os07g05520 | intergenic_region ; MODIFIER | silent_mutation | Average:72.103; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702575490 | 9.02E-06 | 4.79E-06 | mr1070_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 5.39E-06 | NA | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 3.18E-07 | 2.06E-06 | mr1085_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 4.16E-06 | 1.03E-06 | mr1088_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 1.49E-06 | 1.49E-06 | mr1145_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 5.53E-08 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 7.43E-07 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 1.05E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 5.25E-06 | 5.25E-06 | mr1264_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 5.60E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 7.14E-06 | mr1437_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | 9.09E-06 | 5.65E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 4.23E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702575490 | NA | 2.99E-06 | mr1739_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |