\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702568831:

Variant ID: vg0702568831 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2568831
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAGCCTAATTGCTACATGATTTGACCATGCGGTGCTACAGTAAACATTTGCTAATTACGGATTAATTAGGCTTAATAAATTCGTCTCCCAGTTTACA[G/A]
GCGGAATTTGTAATTTGTTTTGTTATTAGTCTACATTTAATACTTCAAATGTGTGTCCGTGTATCCGATGTGACACGCCAAAATTTTGCACCCTGAATCT

Reverse complement sequence

AGATTCAGGGTGCAAAATTTTGGCGTGTCACATCGGATACACGGACACACATTTGAAGTATTAAATGTAGACTAATAACAAAACAAATTACAAATTCCGC[C/T]
TGTAAACTGGGAGACGAATTTATTAAGCCTAATTAATCCGTAATTAGCAAATGTTTACTGTAGCACCGCATGGTCAAATCATGTAGCAATTAGGCTTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 37.20% 0.47% 5.92% NA
All Indica  2759 92.50% 5.10% 0.47% 1.99% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 15.20% 1.10% 1.86% 81.78% NA
Indica I  595 84.90% 14.50% 0.67% 0.00% NA
Indica II  465 95.50% 3.90% 0.43% 0.22% NA
Indica III  913 95.80% 0.30% 0.22% 3.61% NA
Indica Intermediate  786 92.50% 4.20% 0.64% 2.67% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 37.80% 55.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702568831 G -> DEL N N silent_mutation Average:32.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0702568831 G -> A LOC_Os07g05500.1 downstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:32.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0702568831 G -> A LOC_Os07g05510.1 downstream_gene_variant ; 272.0bp to feature; MODIFIER silent_mutation Average:32.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0702568831 G -> A LOC_Os07g05500-LOC_Os07g05510 intergenic_region ; MODIFIER silent_mutation Average:32.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702568831 NA 6.25E-09 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 4.08E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 1.48E-89 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 7.13E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 7.81E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 1.20E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 1.93E-37 mr1733 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 2.77E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 3.13E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 2.02E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 7.32E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 2.18E-06 1.18E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 3.61E-07 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 7.85E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702568831 NA 8.32E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251