Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702566842:

Variant ID: vg0702566842 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2566842
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGTTTGTGTGTGCAGGAAAGTTTTGATGTGATGGAAAAGTTTGAAGTTTGAAGAAAAACTTGGGAACTAAACCAAGCCTTAGTTTTCAAATTTTTCTT[C/T]
AAACTTTCATCTTCTCCATCACATCAAAACTTTCCTACATACACAAACTTTCAACTTTTCTGTCACATCGTTCTAATTTCAATCAAATTTCCAATTTTGA

Reverse complement sequence

TCAAAATTGGAAATTTGATTGAAATTAGAACGATGTGACAGAAAAGTTGAAAGTTTGTGTATGTAGGAAAGTTTTGATGTGATGGAGAAGATGAAAGTTT[G/A]
AAGAAAAATTTGAAAACTAAGGCTTGGTTTAGTTCCCAAGTTTTTCTTCAAACTTCAAACTTTTCCATCACATCAAAACTTTCCTGCACACACAAACTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.50%	39.40%	0.74%	5.42%	NA
All Indica	2759	89.20%	8.50%	1.09%	1.16%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	14.50%	3.00%	1.12%	81.41%	NA
Indica I	595	80.80%	19.20%	0.00%	0.00%	NA
Indica II	465	90.10%	9.50%	0.22%	0.22%	NA
Indica III	913	95.10%	1.20%	2.85%	0.88%	NA
Indica Intermediate	786	88.30%	8.40%	0.38%	2.93%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	71.90%	1.04%	2.08%	NA
Intermediate	90	38.90%	56.70%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702566842	C -> DEL	N	N	silent_mutation	Average:17.013; most accessible tissue: Callus, score: 30.388	N	N	N	N
vg0702566842	C -> T	LOC_Os07g05490.1	downstream_gene_variant ; 3100.0bp to feature; MODIFIER	silent_mutation	Average:17.013; most accessible tissue: Callus, score: 30.388	N	N	N	N
vg0702566842	C -> T	LOC_Os07g05510.1	downstream_gene_variant ; 2261.0bp to feature; MODIFIER	silent_mutation	Average:17.013; most accessible tissue: Callus, score: 30.388	N	N	N	N
vg0702566842	C -> T	LOC_Os07g05500.1	intron_variant ; MODIFIER	silent_mutation	Average:17.013; most accessible tissue: Callus, score: 30.388	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702566842	1.42E-06	1.42E-06	mr1025	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	1.22E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	4.72E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	6.68E-06	NA	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	7.24E-07	7.23E-07	mr1398	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	4.81E-38	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	6.47E-06	NA	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	1.62E-09	1.62E-09	mr1551	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	1.13E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	1.57E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	2.71E-07	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	5.39E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	5.93E-07	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	NA	1.38E-15	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842	5.35E-08	5.35E-08	mr1978	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251