\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702566842:

Variant ID: vg0702566842 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2566842
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGTTTGTGTGTGCAGGAAAGTTTTGATGTGATGGAAAAGTTTGAAGTTTGAAGAAAAACTTGGGAACTAAACCAAGCCTTAGTTTTCAAATTTTTCTT[C/T]
AAACTTTCATCTTCTCCATCACATCAAAACTTTCCTACATACACAAACTTTCAACTTTTCTGTCACATCGTTCTAATTTCAATCAAATTTCCAATTTTGA

Reverse complement sequence

TCAAAATTGGAAATTTGATTGAAATTAGAACGATGTGACAGAAAAGTTGAAAGTTTGTGTATGTAGGAAAGTTTTGATGTGATGGAGAAGATGAAAGTTT[G/A]
AAGAAAAATTTGAAAACTAAGGCTTGGTTTAGTTCCCAAGTTTTTCTTCAAACTTCAAACTTTTCCATCACATCAAAACTTTCCTGCACACACAAACTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 39.40% 0.74% 5.42% NA
All Indica  2759 89.20% 8.50% 1.09% 1.16% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 14.50% 3.00% 1.12% 81.41% NA
Indica I  595 80.80% 19.20% 0.00% 0.00% NA
Indica II  465 90.10% 9.50% 0.22% 0.22% NA
Indica III  913 95.10% 1.20% 2.85% 0.88% NA
Indica Intermediate  786 88.30% 8.40% 0.38% 2.93% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 71.90% 1.04% 2.08% NA
Intermediate  90 38.90% 56.70% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702566842 C -> DEL N N silent_mutation Average:17.013; most accessible tissue: Callus, score: 30.388 N N N N
vg0702566842 C -> T LOC_Os07g05490.1 downstream_gene_variant ; 3100.0bp to feature; MODIFIER silent_mutation Average:17.013; most accessible tissue: Callus, score: 30.388 N N N N
vg0702566842 C -> T LOC_Os07g05510.1 downstream_gene_variant ; 2261.0bp to feature; MODIFIER silent_mutation Average:17.013; most accessible tissue: Callus, score: 30.388 N N N N
vg0702566842 C -> T LOC_Os07g05500.1 intron_variant ; MODIFIER silent_mutation Average:17.013; most accessible tissue: Callus, score: 30.388 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702566842 1.42E-06 1.42E-06 mr1025 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 1.22E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 4.72E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 6.68E-06 NA mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 7.24E-07 7.23E-07 mr1398 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 4.81E-38 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 6.47E-06 NA mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 1.62E-09 1.62E-09 mr1551 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 1.13E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 1.57E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 2.71E-07 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 5.39E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 5.93E-07 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 NA 1.38E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702566842 5.35E-08 5.35E-08 mr1978 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251