\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702564992:

Variant ID: vg0702564992 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2564992
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTTTTTGGAAAAATCACGTGGATTCATTTTCTATAGGAAGGGTTTGTTGTGGCATGAAATTACATTACTGTATATTTTATATTCCTATGTTGTCAAAC[A/G]
TCAAAGGTTTAATAGCAATAATATAAGGGATTTTGAGTTTTTGCTTGCACTATTTGAACACTCGTCTTATTTAAAAAAATTTAAAATTATTATTATTTTT

Reverse complement sequence

AAAAATAATAATAATTTTAAATTTTTTTAAATAAGACGAGTGTTCAAATAGTGCAAGCAAAAACTCAAAATCCCTTATATTATTGCTATTAAACCTTTGA[T/C]
GTTTGACAACATAGGAATATAAAATATACAGTAATGTAATTTCATGCCACAACAAACCCTTCCTATAGAAAATGAATCCACGTGATTTTTCCAAAAAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 37.80% 0.36% 0.00% NA
All Indica  2759 93.30% 6.30% 0.43% 0.00% NA
All Japonica  1512 0.90% 98.90% 0.13% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 84.20% 14.80% 1.01% 0.00% NA
Indica II  465 93.50% 5.80% 0.65% 0.00% NA
Indica III  913 99.10% 0.80% 0.11% 0.00% NA
Indica Intermediate  786 93.10% 6.60% 0.25% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.20% 0.20% 0.00% NA
Japonica Intermediate  241 0.00% 99.60% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702564992 A -> G LOC_Os07g05500.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0702564992 A -> G LOC_Os07g05490.1 downstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0702564992 A -> G LOC_Os07g05510.1 downstream_gene_variant ; 4111.0bp to feature; MODIFIER silent_mutation Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0702564992 A -> G LOC_Os07g05490-LOC_Os07g05500 intergenic_region ; MODIFIER silent_mutation Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702564992 NA 4.98E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.22E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 3.25E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.40E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.18E-41 mr1542 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.09E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 3.02E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 2.98E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 8.08E-32 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.14E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 5.82E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 1.70E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 6.44E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 5.58E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 9.72E-19 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992 NA 2.59E-44 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251