Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702564992:

Variant ID: vg0702564992 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2564992
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTTTTTGGAAAAATCACGTGGATTCATTTTCTATAGGAAGGGTTTGTTGTGGCATGAAATTACATTACTGTATATTTTATATTCCTATGTTGTCAAAC[A/G]
TCAAAGGTTTAATAGCAATAATATAAGGGATTTTGAGTTTTTGCTTGCACTATTTGAACACTCGTCTTATTTAAAAAAATTTAAAATTATTATTATTTTT

Reverse complement sequence

AAAAATAATAATAATTTTAAATTTTTTTAAATAAGACGAGTGTTCAAATAGTGCAAGCAAAAACTCAAAATCCCTTATATTATTGCTATTAAACCTTTGA[T/C]
GTTTGACAACATAGGAATATAAAATATACAGTAATGTAATTTCATGCCACAACAAACCCTTCCTATAGAAAATGAATCCACGTGATTTTTCCAAAAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	37.80%	0.36%	0.00%	NA
All Indica	2759	93.30%	6.30%	0.43%	0.00%	NA
All Japonica	1512	0.90%	98.90%	0.13%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	84.20%	14.80%	1.01%	0.00%	NA
Indica II	465	93.50%	5.80%	0.65%	0.00%	NA
Indica III	913	99.10%	0.80%	0.11%	0.00%	NA
Indica Intermediate	786	93.10%	6.60%	0.25%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	2.60%	97.20%	0.20%	0.00%	NA
Japonica Intermediate	241	0.00%	99.60%	0.41%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	45.60%	51.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702564992	A -> G	LOC_Os07g05500.1	upstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289	N	N	N	N
vg0702564992	A -> G	LOC_Os07g05490.1	downstream_gene_variant ; 1250.0bp to feature; MODIFIER	silent_mutation	Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289	N	N	N	N
vg0702564992	A -> G	LOC_Os07g05510.1	downstream_gene_variant ; 4111.0bp to feature; MODIFIER	silent_mutation	Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289	N	N	N	N
vg0702564992	A -> G	LOC_Os07g05490-LOC_Os07g05500	intergenic_region ; MODIFIER	silent_mutation	Average:39.923; most accessible tissue: Zhenshan97 flower, score: 72.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702564992	NA	4.98E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.22E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	3.25E-87	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.40E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.18E-41	mr1542	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.09E-43	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	3.02E-57	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	2.98E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	8.08E-32	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.14E-34	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	5.82E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	1.70E-87	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	6.44E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	5.58E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	9.72E-19	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702564992	NA	2.59E-44	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251