\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702551779:

Variant ID: vg0702551779 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2551779
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGAGGTACACGAAGATTCAAGTAGAGGAACGGGAAATTCTATGCATGTGCAATTAATTAAGCAGTACTCCCTCCGTTTTATATTATAAGACTTTCTAG[C/T]
ATTGTCCATATTCATATAGATGTTATGTCTAGAACTTTCTAGCATTGTCCATATTCATATAGATGTTATGTCTAGATTAATTAACATCTATAGAATATGG

Reverse complement sequence

CCATATTCTATAGATGTTAATTAATCTAGACATAACATCTATATGAATATGGACAATGCTAGAAAGTTCTAGACATAACATCTATATGAATATGGACAAT[G/A]
CTAGAAAGTCTTATAATATAAAACGGAGGGAGTACTGCTTAATTAATTGCACATGCATAGAATTTCCCGTTCCTCTACTTGAATCTTCGTGTACCTCCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 13.00% 4.13% 0.00% NA
All Indica  2759 71.90% 21.20% 6.81% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 95.50% 3.70% 0.74% 0.00% NA
Indica I  595 74.30% 14.80% 10.92% 0.00% NA
Indica II  465 69.20% 23.90% 6.88% 0.00% NA
Indica III  913 72.00% 24.00% 4.05% 0.00% NA
Indica Intermediate  786 71.80% 21.40% 6.87% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702551779 C -> T LOC_Os07g05480.1 downstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:32.619; most accessible tissue: Callus, score: 70.48 N N N N
vg0702551779 C -> T LOC_Os07g05480.2 downstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:32.619; most accessible tissue: Callus, score: 70.48 N N N N
vg0702551779 C -> T LOC_Os07g05480-LOC_Os07g05490 intergenic_region ; MODIFIER silent_mutation Average:32.619; most accessible tissue: Callus, score: 70.48 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702551779 NA 2.81E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.18E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.29E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 7.01E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.07E-49 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 7.23E-48 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.61E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.76E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.69E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.78E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 5.50E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.42E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.35E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.95E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 5.02E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.55E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.83E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.00E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 5.50E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.46E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.28E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.69E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.57E-27 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.89E-20 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.36E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.45E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.59E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.16E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.35E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.65E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.94E-59 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.04E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.50E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.94E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.10E-46 mr1721 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 4.53E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.31E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.94E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 5.60E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.12E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 8.59E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.38E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 2.32E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.69E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.19E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 6.91E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.63E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 3.75E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 9.80E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 8.08E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702551779 NA 1.33E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251