\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702524727:

Variant ID: vg0702524727 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2524727
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCAATCACTGAAGACTTGGTTCTCACGTGAAGAGAGAACGTGCGCTTGTGGCCGTTTGGCGGCTGCGTTTCTCACGGAGCCGATCCGGCTTTGACGCG[G/A]
AGGAGCAACGGATTGAGCATGGACTGCCGTTCAGTGTTAGCTCTATATAGGAGTCAAGGAGACGTCTTTGAAGGACACAGAACACAACAGCCATCTACTC

Reverse complement sequence

GAGTAGATGGCTGTTGTGTTCTGTGTCCTTCAAAGACGTCTCCTTGACTCCTATATAGAGCTAACACTGAACGGCAGTCCATGCTCAATCCGTTGCTCCT[C/T]
CGCGTCAAAGCCGGATCGGCTCCGTGAGAAACGCAGCCGCCAAACGGCCACAAGCGCACGTTCTCTCTTCACGTGAGAACCAAGTCTTCAGTGATTGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 42.50% 0.74% 0.61% NA
All Indica  2759 91.80% 6.10% 1.12% 0.98% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 17.50% 81.40% 1.12% 0.00% NA
Indica I  595 83.90% 15.10% 0.67% 0.34% NA
Indica II  465 93.50% 3.90% 1.51% 1.08% NA
Indica III  913 95.80% 1.00% 1.42% 1.75% NA
Indica Intermediate  786 92.20% 6.40% 0.89% 0.51% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 36.70% 60.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702524727 G -> DEL N N silent_mutation Average:69.246; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0702524727 G -> A LOC_Os07g05460-LOC_Os07g05470 intergenic_region ; MODIFIER silent_mutation Average:69.246; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0702524727 G A -0.15 -0.07 -0.04 -0.04 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702524727 NA 2.51E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 9.42E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 1.88E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 4.32E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 2.88E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 1.13E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 3.18E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 5.83E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 2.04E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 9.60E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 2.94E-06 5.18E-30 mr1551 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 3.19E-07 3.19E-07 mr1551 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 3.46E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 8.42E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 7.19E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 1.46E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 1.38E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 3.11E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 3.17E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524727 NA 1.91E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251