\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702524630:

Variant ID: vg0702524630 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2524630
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGATCATTTCATCAATTTAAATGCCTAATGCTTAGCCGCACGATCAGCATGTGTTGATGAAAAGATGCTTGCATACAACAACCTCTGCTGATCGAGT[C/T]
AATCACTGAAGACTTGGTTCTCACGTGAAGAGAGAACGTGCGCTTGTGGCCGTTTGGCGGCTGCGTTTCTCACGGAGCCGATCCGGCTTTGACGCGGAGG

Reverse complement sequence

CCTCCGCGTCAAAGCCGGATCGGCTCCGTGAGAAACGCAGCCGCCAAACGGCCACAAGCGCACGTTCTCTCTTCACGTGAGAACCAAGTCTTCAGTGATT[G/A]
ACTCGATCAGCAGAGGTTGTTGTATGCAAGCATCTTTTCATCAACACATGCTGATCGTGCGGCTAAGCATTAGGCATTTAAATTGATGAAATGATCAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.10% 0.04% 0.34% NA
All Indica  2759 94.60% 4.90% 0.07% 0.47% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 84.50% 14.80% 0.00% 0.67% NA
Indica II  465 95.90% 3.70% 0.22% 0.22% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 95.70% 3.60% 0.13% 0.64% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 42.20% 54.40% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702524630 C -> DEL N N silent_mutation Average:76.986; most accessible tissue: Minghui63 panicle, score: 92.231 N N N N
vg0702524630 C -> T LOC_Os07g05460-LOC_Os07g05470 intergenic_region ; MODIFIER silent_mutation Average:76.986; most accessible tissue: Minghui63 panicle, score: 92.231 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0702524630 C T -0.11 -0.04 -0.03 -0.05 -0.09 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702524630 NA 4.31E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 7.14E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 1.82E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 1.15E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 3.00E-39 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 6.11E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 4.34E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 9.04E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 4.35E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 2.13E-06 3.44E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 2.99E-06 4.15E-08 mr1804 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 4.40E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 3.27E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702524630 NA 3.01E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251