\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702509111:

Variant ID: vg0702509111 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2509111
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CGTACCCTTATAAATTGATGGCTCAAATTATTTCTTTGCTGACACTAATAAGTACACACCAAGTGATGTGGTGATAAAGTTATCTATCACACACGCGTGT[G/T]
TATGTTTAATTTCCAACTTATTCACTCGATCTAAATATATATTTCATAGAGTCGCTCTGGTGATAGAGCGTGCCATCTTACAATAATAATCTTTACATAC

Reverse complement sequence

GTATGTAAAGATTATTATTGTAAGATGGCACGCTCTATCACCAGAGCGACTCTATGAAATATATATTTAGATCGAGTGAATAAGTTGGAAATTAAACATA[C/A]
ACACGCGTGTGTGATAGATAACTTTATCACCACATCACTTGGTGTGTACTTATTAGTGTCAGCAAAGAAATAATTTGAGCCATCAATTTATAAGGGTACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.00% 0.02% 0.32% NA
All Indica  2759 93.10% 6.40% 0.04% 0.47% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 83.90% 15.50% 0.00% 0.67% NA
Indica II  465 95.50% 3.90% 0.00% 0.65% NA
Indica III  913 98.40% 1.40% 0.00% 0.22% NA
Indica Intermediate  786 92.60% 6.70% 0.13% 0.51% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702509111 G -> DEL N N silent_mutation Average:53.857; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0702509111 G -> T LOC_Os07g05440.1 downstream_gene_variant ; 1347.0bp to feature; MODIFIER silent_mutation Average:53.857; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0702509111 G -> T LOC_Os07g05450.1 downstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:53.857; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0702509111 G -> T LOC_Os07g05440.2 downstream_gene_variant ; 1347.0bp to feature; MODIFIER silent_mutation Average:53.857; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N
vg0702509111 G -> T LOC_Os07g05440-LOC_Os07g05450 intergenic_region ; MODIFIER silent_mutation Average:53.857; most accessible tissue: Zhenshan97 root, score: 86.579 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702509111 NA 2.65E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.99E-27 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 3.80E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.64E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.67E-36 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.39E-50 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.14E-37 mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 7.20E-44 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 8.92E-50 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.06E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.20E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 3.28E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.06E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.16E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 6.34E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.79E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 3.00E-31 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.41E-32 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 5.65E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 6.83E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.45E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 7.79E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 6.60E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 5.20E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 3.28E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.07E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 3.79E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 5.31E-28 mr1537 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.04E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.77E-27 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.74E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.90E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.88E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.14E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.29E-61 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.54E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.52E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.69E-41 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.70E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.05E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 8.16E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.69E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 7.56E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 6.75E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.25E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.77E-09 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.27E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 4.04E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.57E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.36E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.03E-11 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 8.82E-17 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 8.05E-46 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 1.13E-39 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.62E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 8.32E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 5.98E-47 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702509111 NA 2.07E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251