\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702446282:

Variant ID: vg0702446282 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2446282
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTCTCTTAAATTATTTATCCAAATCATGATTCGATTACACCATTAAATTCATTGCAATTAAATCTTTAAAACAAGACCACACATGGATATATTCCGA[C/T]
GAAATTTTTTTAGCTTATTATTGAATTATTTTTAAATGTTGCACAATGTTCCACCAAGTATATCGGAATTGTTTCACTGAGTAGATAGAAAATATTTCAA

Reverse complement sequence

TTGAAATATTTTCTATCTACTCAGTGAAACAATTCCGATATACTTGGTGGAACATTGTGCAACATTTAAAAATAATTCAATAATAAGCTAAAAAAATTTC[G/A]
TCGGAATATATCCATGTGTGGTCTTGTTTTAAAGATTTAATTGCAATGAATTTAATGGTGTAATCGAATCATGATTTGGATAAATAATTTAAGAGAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 5.50% 0.59% 0.42% NA
All Indica  2759 97.40% 1.20% 0.76% 0.72% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 14.50% 83.60% 1.86% 0.00% NA
Indica I  595 97.60% 0.70% 0.67% 1.01% NA
Indica II  465 95.70% 0.20% 2.80% 1.29% NA
Indica III  913 99.10% 0.50% 0.00% 0.33% NA
Indica Intermediate  786 96.10% 2.80% 0.51% 0.64% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702446282 C -> DEL N N silent_mutation Average:32.028; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0702446282 C -> T LOC_Os07g05350.1 downstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:32.028; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0702446282 C -> T LOC_Os07g05330-LOC_Os07g05350 intergenic_region ; MODIFIER silent_mutation Average:32.028; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702446282 NA 4.67E-32 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 6.61E-28 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 6.26E-29 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 3.05E-26 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 2.56E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 1.84E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 7.33E-23 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 2.48E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 2.26E-25 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 7.81E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 1.71E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 1.09E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 9.59E-31 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 5.17E-18 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 4.03E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 2.04E-21 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 2.93E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 4.63E-06 NA mr1320_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 5.49E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 8.19E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 8.02E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 3.18E-14 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702446282 NA 9.31E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251