Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702444355:

Variant ID: vg0702444355 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2444355
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

CAATTGTTAGGTATCAACAGTACATCACAAAACACAATCTATAAAACAAATTAGTAATGCTGTTGATAAATCCCAATATTCTTATGTAATTTTAGATTTG[T/C]
ATAACAAATATTTTAAAAAAATAATAGCCAAACACCATGGTATTAACTATTCAGTGCTAAAAAAAGAATTCAGGTTATTTTGTGATTTCTGGAAATTCCT

Reverse complement sequence

AGGAATTTCCAGAAATCACAAAATAACCTGAATTCTTTTTTTAGCACTGAATAGTTAATACCATGGTGTTTGGCTATTATTTTTTTAAAATATTTGTTAT[A/G]
CAAATCTAAAATTACATAAGAATATTGGGATTTATCAACAGCATTACTAATTTGTTTTATAGATTGTGTTTTGTGATGTACTGTTGATACCTAACAATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	37.60%	17.05%	5.78%	NA
All Indica	2759	56.50%	5.90%	28.13%	9.50%	NA
All Japonica	1512	0.90%	98.30%	0.73%	0.07%	NA
Aus	269	94.40%	1.50%	2.97%	1.12%	NA
Indica I	595	41.00%	16.50%	35.80%	6.72%	NA
Indica II	465	59.80%	4.10%	28.17%	7.96%	NA
Indica III	913	64.10%	0.80%	22.23%	12.92%	NA
Indica Intermediate	786	57.50%	4.80%	29.13%	8.52%	NA
Temperate Japonica	767	0.00%	99.90%	0.13%	0.00%	NA
Tropical Japonica	504	2.00%	97.20%	0.60%	0.20%	NA
Japonica Intermediate	241	1.70%	95.40%	2.90%	0.00%	NA
VI/Aromatic	96	18.80%	72.90%	3.12%	5.21%	NA
Intermediate	90	27.80%	61.10%	8.89%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702444355	T -> DEL	N	N	silent_mutation	Average:12.233; most accessible tissue: Callus, score: 21.069	N	N	N	N
vg0702444355	T -> C	LOC_Os07g05350.1	downstream_gene_variant ; 3523.0bp to feature; MODIFIER	silent_mutation	Average:12.233; most accessible tissue: Callus, score: 21.069	N	N	N	N
vg0702444355	T -> C	LOC_Os07g05330-LOC_Os07g05350	intergenic_region ; MODIFIER	silent_mutation	Average:12.233; most accessible tissue: Callus, score: 21.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702444355	NA	4.70E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	2.90E-06	mr1371	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	3.82E-37	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	2.56E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	3.06E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	4.95E-06	4.95E-06	mr1688	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	4.20E-09	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	5.01E-07	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	1.37E-17	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702444355	NA	2.03E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251