\
| Variant ID: vg0702437436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2437436 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTCATTAAGGGCATAAAAAAAACTCCGGTTCATTGTTGCTTGGAGCAGCCTTATTTTCCGGGAATCTTCTCATTTTTACATGTAATTTAAATAGCTGTTT[T/C]
TTTTAAAAAAAAGGTATAATTGATCAATACGAAATATGTCAGTTTCACAGAAAAATCAAATTCAACATAGACAAGTAAAAAAAAATGATAGATTTGACTG
CAGTCAAATCTATCATTTTTTTTTACTTGTCTATGTTGAATTTGATTTTTCTGTGAAACTGACATATTTCGTATTGATCAATTATACCTTTTTTTTAAAA[A/G]
AAACAGCTATTTAAATTACATGTAAAAATGAGAAGATTCCCGGAAAATAAGGCTGCTCCAAGCAACAATGAACCGGAGTTTTTTTTATGCCCTTAATGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.10% | 5.80% | 1.97% | 60.18% | NA |
| All Indica | 2759 | 7.40% | 0.50% | 1.01% | 91.12% | NA |
| All Japonica | 1512 | 78.90% | 16.40% | 3.84% | 0.86% | NA |
| Aus | 269 | 1.10% | 0.70% | 1.86% | 96.28% | NA |
| Indica I | 595 | 17.60% | 0.00% | 1.34% | 81.01% | NA |
| Indica II | 465 | 5.20% | 2.20% | 1.51% | 91.18% | NA |
| Indica III | 913 | 2.10% | 0.10% | 0.11% | 97.70% | NA |
| Indica Intermediate | 786 | 7.00% | 0.40% | 1.53% | 91.09% | NA |
| Temperate Japonica | 767 | 93.00% | 3.70% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 59.50% | 34.70% | 3.17% | 2.58% | NA |
| Japonica Intermediate | 241 | 74.70% | 18.70% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 0.00% | 27.08% | NA |
| Intermediate | 90 | 53.30% | 8.90% | 2.22% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702437436 | T -> DEL | N | N | silent_mutation | Average:10.361; most accessible tissue: Callus, score: 58.359 | N | N | N | N |
| vg0702437436 | T -> C | LOC_Os07g05330.1 | upstream_gene_variant ; 2753.0bp to feature; MODIFIER | silent_mutation | Average:10.361; most accessible tissue: Callus, score: 58.359 | N | N | N | N |
| vg0702437436 | T -> C | LOC_Os07g05330-LOC_Os07g05350 | intergenic_region ; MODIFIER | silent_mutation | Average:10.361; most accessible tissue: Callus, score: 58.359 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702437436 | 6.28E-07 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702437436 | 3.33E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702437436 | 2.80E-07 | NA | mr1023_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702437436 | NA | 8.24E-07 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702437436 | 1.07E-08 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702437436 | 1.20E-08 | NA | mr1778_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |