\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702433302:

Variant ID: vg0702433302 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2433302
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTCGGGCTAATAGTTATCACGGTGAACAGTTTACATATTATGTTTACTTACCCCTTCTTTAGGGGGAATGTAGTCTTTGTCGCCTTCTTCACCGTCG[C/T]
CCTTTTTCCTTCTCTTCGGGCTTGGGCTTGGACAAGGATCGCTTGGTGATGAGTACTCATCGTCTTCGTGAGCTACGTCGCTGCCGGAACTATCTTCTGG

Reverse complement sequence

CCAGAAGATAGTTCCGGCAGCGACGTAGCTCACGAAGACGATGAGTACTCATCACCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGG[G/A]
CGACGGTGAAGAAGGCGACAAAGACTACATTCCCCCTAAAGAAGGGGTAAGTAAACATAATATGTAAACTGTTCACCGTGATAACTATTAGCCCGAGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 5.50% 19.97% 32.16% NA
All Indica  2759 22.90% 0.10% 26.75% 50.24% NA
All Japonica  1512 79.10% 16.70% 3.44% 0.79% NA
Aus  269 13.80% 0.00% 51.30% 34.94% NA
Indica I  595 26.60% 0.00% 16.13% 57.31% NA
Indica II  465 42.80% 0.00% 22.37% 34.84% NA
Indica III  913 11.60% 0.10% 36.80% 51.48% NA
Indica Intermediate  786 21.50% 0.30% 25.70% 52.54% NA
Temperate Japonica  767 98.20% 1.00% 0.78% 0.00% NA
Tropical Japonica  504 51.60% 41.70% 4.37% 2.38% NA
Japonica Intermediate  241 75.90% 14.10% 9.96% 0.00% NA
VI/Aromatic  96 82.30% 0.00% 5.21% 12.50% NA
Intermediate  90 62.20% 7.80% 12.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702433302 C -> DEL LOC_Os07g05330.1 N frameshift_variant Average:7.774; most accessible tissue: Callus, score: 21.24 N N N N
vg0702433302 C -> T LOC_Os07g05330.1 missense_variant ; p.Gly428Asp; MODERATE nonsynonymous_codon ; G428D Average:7.774; most accessible tissue: Callus, score: 21.24 probably damaging 2.142 TOLERATED 0.16

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702433302 3.17E-06 8.71E-10 mr1022_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 2.50E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 3.32E-06 3.32E-06 mr1095_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 4.84E-06 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 1.00E-06 2.32E-06 mr1099_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 4.78E-06 4.78E-06 mr1146_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 8.64E-06 8.61E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 9.77E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 4.98E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 2.53E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 4.40E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 9.84E-06 9.84E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 5.00E-06 mr1566_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 6.46E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 3.29E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 2.71E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 5.18E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702433302 NA 7.41E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251