\
| Variant ID: vg0702311142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2311142 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 104. )
TGTAATTTAATATCGAGAAATAATTAGAGTAGTCGTTTCGAAAAGGAGTCCAATTAGACCATGGGAGAAGGTTTCGAAAATGAGTCCAGTTAAATCTCTT[C/G]
ACGACGTACGTACGTTTGTACGTACTCAAAACTAACGCGGAAATAACTGAAAATCAATTGAATTTGGATCAGATTCGGACTCCGGATCACCGCATCCGTC
GACGGATGCGGTGATCCGGAGTCCGAATCTGATCCAAATTCAATTGATTTTCAGTTATTTCCGCGTTAGTTTTGAGTACGTACAAACGTACGTACGTCGT[G/C]
AAGAGATTTAACTGGACTCATTTTCGAAACCTTCTCCCATGGTCTAATTGGACTCCTTTTCGAAACGACTACTCTAATTATTTCTCGATATTAAATTACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 42.00% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 87.00% | 13.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 50.80% | 49.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702311142 | C -> G | LOC_Os07g05180.1 | upstream_gene_variant ; 276.0bp to feature; MODIFIER | silent_mutation | Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0702311142 | C -> G | LOC_Os07g05174.1 | downstream_gene_variant ; 3745.0bp to feature; MODIFIER | silent_mutation | Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0702311142 | C -> G | LOC_Os07g05190.1 | downstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg0702311142 | C -> G | LOC_Os07g05174-LOC_Os07g05180 | intergenic_region ; MODIFIER | silent_mutation | Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702311142 | NA | 1.37E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 6.01E-13 | mr1005 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 3.48E-06 | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 7.23E-15 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 1.17E-22 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 1.01E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 2.45E-15 | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 2.36E-09 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 5.79E-11 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 1.85E-11 | mr1520_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 1.04E-07 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 2.36E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702311142 | NA | 6.83E-19 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |