\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702311142:

Variant ID: vg0702311142 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2311142
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAATTTAATATCGAGAAATAATTAGAGTAGTCGTTTCGAAAAGGAGTCCAATTAGACCATGGGAGAAGGTTTCGAAAATGAGTCCAGTTAAATCTCTT[C/G]
ACGACGTACGTACGTTTGTACGTACTCAAAACTAACGCGGAAATAACTGAAAATCAATTGAATTTGGATCAGATTCGGACTCCGGATCACCGCATCCGTC

Reverse complement sequence

GACGGATGCGGTGATCCGGAGTCCGAATCTGATCCAAATTCAATTGATTTTCAGTTATTTCCGCGTTAGTTTTGAGTACGTACAAACGTACGTACGTCGT[G/C]
AAGAGATTTAACTGGACTCATTTTCGAAACCTTCTCCCATGGTCTAATTGGACTCCTTTTCGAAACGACTACTCTAATTATTTCTCGATATTAAATTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 42.00% 0.02% 0.00% NA
All Indica  2759 87.00% 13.00% 0.00% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 50.80% 49.20% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 87.70% 12.30% 0.00% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702311142 C -> G LOC_Os07g05180.1 upstream_gene_variant ; 276.0bp to feature; MODIFIER silent_mutation Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0702311142 C -> G LOC_Os07g05174.1 downstream_gene_variant ; 3745.0bp to feature; MODIFIER silent_mutation Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0702311142 C -> G LOC_Os07g05190.1 downstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0702311142 C -> G LOC_Os07g05174-LOC_Os07g05180 intergenic_region ; MODIFIER silent_mutation Average:52.442; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702311142 NA 1.37E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 6.01E-13 mr1005 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 3.48E-06 mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 7.23E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 1.17E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 1.01E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 2.45E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 2.36E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 5.79E-11 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 1.85E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 1.04E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 2.36E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702311142 NA 6.83E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251