\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702242561:

Variant ID: vg0702242561 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2242561
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTCTAAAATTTAACCACAAGGAGAGATGTGGAATTAAAATGAAGGGCTGTTGAAATTTGTTGAGATAAGAAAATATAGATAAAGAAATTATTAAAATG[A/C]
AGGGATGTTGAAATTTGTTGAGATAAGAAAATATAGATAAAGAAATTAAATGAGAGAATGTTATGATTAGTTGAGACAATGAAAGGGGTAAGCAGCATTA

Reverse complement sequence

TAATGCTGCTTACCCCTTTCATTGTCTCAACTAATCATAACATTCTCTCATTTAATTTCTTTATCTATATTTTCTTATCTCAACAAATTTCAACATCCCT[T/G]
CATTTTAATAATTTCTTTATCTATATTTTCTTATCTCAACAAATTTCAACAGCCCTTCATTTTAATTCCACATCTCTCCTTGTGGTTAAATTTTAGAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 46.90% 0.25% 0.00% NA
All Indica  2759 21.50% 78.20% 0.33% 0.00% NA
All Japonica  1512 99.00% 0.90% 0.13% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 2.50% 97.10% 0.34% 0.00% NA
Indica II  465 49.00% 50.30% 0.65% 0.00% NA
Indica III  913 20.50% 79.20% 0.33% 0.00% NA
Indica Intermediate  786 20.70% 79.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 97.20% 2.60% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 66.70% 32.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702242561 A -> C LOC_Os07g05084.1 upstream_gene_variant ; 1113.0bp to feature; MODIFIER silent_mutation Average:23.638; most accessible tissue: Callus, score: 38.524 N N N N
vg0702242561 A -> C LOC_Os07g05070-LOC_Os07g05084 intergenic_region ; MODIFIER silent_mutation Average:23.638; most accessible tissue: Callus, score: 38.524 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702242561 NA 4.25E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 3.78E-16 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 1.76E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 2.58E-06 NA mr1410 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 1.66E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 4.93E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 2.37E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 4.60E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 6.64E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 5.38E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 7.15E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 2.02E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 1.13E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 1.65E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 2.24E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 5.09E-10 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 4.60E-10 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561 NA 8.36E-24 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251