Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702242561:

Variant ID: vg0702242561 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2242561
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTCTAAAATTTAACCACAAGGAGAGATGTGGAATTAAAATGAAGGGCTGTTGAAATTTGTTGAGATAAGAAAATATAGATAAAGAAATTATTAAAATG[A/C]
AGGGATGTTGAAATTTGTTGAGATAAGAAAATATAGATAAAGAAATTAAATGAGAGAATGTTATGATTAGTTGAGACAATGAAAGGGGTAAGCAGCATTA

Reverse complement sequence

TAATGCTGCTTACCCCTTTCATTGTCTCAACTAATCATAACATTCTCTCATTTAATTTCTTTATCTATATTTTCTTATCTCAACAAATTTCAACATCCCT[T/G]
CATTTTAATAATTTCTTTATCTATATTTTCTTATCTCAACAAATTTCAACAGCCCTTCATTTTAATTCCACATCTCTCCTTGTGGTTAAATTTTAGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	46.90%	0.25%	0.00%	NA
All Indica	2759	21.50%	78.20%	0.33%	0.00%	NA
All Japonica	1512	99.00%	0.90%	0.13%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	2.50%	97.10%	0.34%	0.00%	NA
Indica II	465	49.00%	50.30%	0.65%	0.00%	NA
Indica III	913	20.50%	79.20%	0.33%	0.00%	NA
Indica Intermediate	786	20.70%	79.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	97.20%	2.60%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702242561	A -> C	LOC_Os07g05084.1	upstream_gene_variant ; 1113.0bp to feature; MODIFIER	silent_mutation	Average:23.638; most accessible tissue: Callus, score: 38.524	N	N	N	N
vg0702242561	A -> C	LOC_Os07g05070-LOC_Os07g05084	intergenic_region ; MODIFIER	silent_mutation	Average:23.638; most accessible tissue: Callus, score: 38.524	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702242561	NA	4.25E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	3.78E-16	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	1.76E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	2.58E-06	NA	mr1410	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	1.66E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	4.93E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	2.37E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	4.60E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	6.64E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	5.38E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	7.15E-21	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	2.02E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	1.13E-09	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	1.65E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	2.24E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	5.09E-10	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	4.60E-10	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702242561	NA	8.36E-24	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251