\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702073123:

Variant ID: vg0702073123 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2073123
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTGACTTGAAGCATGTACTGGCGGTCCTTGTTCTTATTATGTTGTATTTGTGATTTAGTTCTTGTTCTTGAATGGATATGTGGCGTCCTTGAGCTT[G/A,T]
TTCTTGAATAAGGACCAATTAGAGTATGGATCAGGATGTGGATCACAGGGGCACTCAAAAGCATCGACTCCATGAATTGATTCTTCGATCTGGTCTCTCT

Reverse complement sequence

AGAGAGACCAGATCGAAGAATCAATTCATGGAGTCGATGCTTTTGAGTGCCCCTGTGATCCACATCCTGATCCATACTCTAATTGGTCCTTATTCAAGAA[C/T,A]
AAGCTCAAGGACGCCACATATCCATTCAAGAACAAGAACTAAATCACAAATACAACATAATAAGAACAAGGACCGCCAGTACATGCTTCAAGTCAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.90% 0.02% 0.00% NA
All Indica  2759 95.00% 5.00% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 90.10% 9.90% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702073123 G -> A LOC_Os07g04670.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:55.167; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0702073123 G -> A LOC_Os07g04670-LOC_Os07g04690 intergenic_region ; MODIFIER silent_mutation Average:55.167; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0702073123 G -> T LOC_Os07g04670.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER N Average:55.167; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0702073123 G -> T LOC_Os07g04670-LOC_Os07g04690 intergenic_region ; MODIFIER N Average:55.167; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702073123 NA 1.91E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 7.06E-29 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 7.22E-17 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 9.79E-24 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.69E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 6.08E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 4.72E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 4.79E-28 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.72E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 3.47E-08 mr1331 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 3.82E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.97E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.20E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 8.27E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 6.85E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.46E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.15E-22 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.42E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.72E-38 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 8.14E-42 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.11E-30 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.06E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 8.59E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.62E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 3.46E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 9.87E-15 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 4.07E-38 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.43E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.49E-20 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 4.56E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.61E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.76E-27 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.22E-27 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.85E-13 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.91E-11 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.99E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.82E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 6.79E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 7.69E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 8.41E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.87E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 1.52E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.35E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 3.51E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 5.38E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 7.83E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 6.64E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 4.14E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.51E-14 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 8.98E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702073123 NA 2.81E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251