Variant ID: vg0701738802 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 1738802 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAGGTATGCTGCCTCCTGACATGCGTGATCTGCTGTGCCTCCAGACGCCTCAACCACCATGTTAGCGAGGCAAGTACCCACATAGCCATGGACCTCCAGG[C/T]
GGACACGGTGAGGAAGCTCGCCACTGAGCGGTGGAACAGTTGTGTACTCTGGCGCGTTGGGGTAGCCCACCACCAGTGTCATGCGTGCCAATTCTGCCAC
GTGGCAGAATTGGCACGCATGACACTGGTGGTGGGCTACCCCAACGCGCCAGAGTACACAACTGTTCCACCGCTCAGTGGCGAGCTTCCTCACCGTGTCC[G/A]
CCTGGAGGTCCATGGCTATGTGGGTACTTGCCTCGCTAACATGGTGGTTGAGGCGTCTGGAGGCACAGCAGATCACGCATGTCAGGAGGCAGCATACCTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 23.80% | 6.20% | 11.09% | 58.82% | NA |
All Indica | 2759 | 22.40% | 1.80% | 14.86% | 60.89% | NA |
All Japonica | 1512 | 20.80% | 14.30% | 2.31% | 62.57% | NA |
Aus | 269 | 39.80% | 0.40% | 20.07% | 39.78% | NA |
Indica I | 595 | 15.60% | 0.00% | 11.60% | 72.77% | NA |
Indica II | 465 | 12.30% | 8.20% | 7.74% | 71.83% | NA |
Indica III | 913 | 31.90% | 0.30% | 19.28% | 48.52% | NA |
Indica Intermediate | 786 | 22.60% | 1.10% | 16.41% | 59.80% | NA |
Temperate Japonica | 767 | 33.50% | 0.50% | 1.96% | 64.02% | NA |
Tropical Japonica | 504 | 4.80% | 39.50% | 2.38% | 53.37% | NA |
Japonica Intermediate | 241 | 14.10% | 5.40% | 3.32% | 77.18% | NA |
VI/Aromatic | 96 | 62.50% | 14.60% | 14.58% | 8.33% | NA |
Intermediate | 90 | 28.90% | 15.60% | 12.22% | 43.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0701738802 | C -> DEL | LOC_Os07g04100.1 | N | frameshift_variant | Average:19.903; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
vg0701738802 | C -> T | LOC_Os07g04100.1 | missense_variant ; p.Arg50His; MODERATE | nonsynonymous_codon ; R50H | Average:19.903; most accessible tissue: Minghui63 young leaf, score: 36.684 | benign | 0.671 | DELETERIOUS | 0.01 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0701738802 | NA | 1.20E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0701738802 | 1.79E-08 | NA | mr1019_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0701738802 | 5.42E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0701738802 | 1.98E-08 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0701738802 | 9.64E-06 | NA | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0701738802 | NA | 2.47E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |