\
| Variant ID: vg0701737366 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1737366 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAGTGACTTCCGTGCCTGGCGGACGTGTGGCCATGTGGTTGTCCCACCGAGCTGACGCGGGACCTTGGAGCTGGTGTGTGGCGAAAGCGACCTTCTCCT[G/T,A]
ATCATTGCACTGCAGGAGATTCAGCTTCTTCTCTATGGCATGGACCCAGTCATTTGCCTCCATGGGGTTGGTGGTGCTGGAGAAAGTGGGTGGCCTGACA
TGTCAGGCCACCCACTTTCTCCAGCACCACCAACCCCATGGAGGCAAATGACTGGGTCCATGCCATAGAGAAGAAGCTGAATCTCCTGCAGTGCAATGAT[C/A,T]
AGGAGAAGGTCGCTTTCGCCACACACCAGCTCCAAGGTCCCGCGTCAGCTCGGTGGGACAACCACATGGCCACACGTCCGCCAGGCACGGAAGTCACTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.60% | 5.40% | 5.01% | 63.82% | A: 0.11% |
| All Indica | 2759 | 23.60% | 1.40% | 5.04% | 69.88% | A: 0.07% |
| All Japonica | 1512 | 20.60% | 13.60% | 4.37% | 61.44% | NA |
| Aus | 269 | 57.60% | 0.40% | 4.09% | 36.80% | A: 1.12% |
| Indica I | 595 | 17.80% | 0.00% | 1.51% | 80.67% | NA |
| Indica II | 465 | 11.60% | 7.10% | 3.87% | 77.42% | NA |
| Indica III | 913 | 30.70% | 0.10% | 7.01% | 62.21% | NA |
| Indica Intermediate | 786 | 27.00% | 0.50% | 6.11% | 66.16% | A: 0.25% |
| Temperate Japonica | 767 | 33.90% | 0.50% | 2.87% | 62.71% | NA |
| Tropical Japonica | 504 | 2.60% | 37.90% | 7.34% | 52.18% | NA |
| Japonica Intermediate | 241 | 15.80% | 4.60% | 2.90% | 76.76% | NA |
| VI/Aromatic | 96 | 65.60% | 4.20% | 10.42% | 19.79% | NA |
| Intermediate | 90 | 34.40% | 7.80% | 12.22% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701737366 | G -> DEL | LOC_Os07g04090.1 | N | frameshift_variant | Average:10.323; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0701737366 | G -> A | LOC_Os07g04090.1 | stop_gained ; p.Gln131*; HIGH | stop_gained | Average:10.323; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0701737366 | G -> T | LOC_Os07g04090.1 | missense_variant ; p.Gln131Lys; MODERATE | nonsynonymous_codon ; Q131K | Average:10.323; most accessible tissue: Minghui63 panicle, score: 20.733 | benign |
0.441 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701737366 | NA | 1.70E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | NA | 8.09E-07 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | NA | 3.23E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | NA | 1.03E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | NA | 4.17E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | 3.34E-06 | NA | mr1835 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | 6.14E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | 6.31E-08 | NA | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | NA | 1.69E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701737366 | 3.24E-07 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |