\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701665457:

Variant ID: vg0701665457 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1665457
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ACCTCAACCCTCACGTGCATTACCATATCCCACCTACTACACATATCTAACTTGAATACAAATGCTTTTTTTTACTAATCCTGGAGACATCTTTAGTACC[G/A]
GAATATTTTTAGTCCAAATTAGTGTTATCAACCGGTACTAAAAATACATCTTTAGTACCAGTTGATAATACCAACCCGGACTAAAGATCCTCTAGCTTTA

Reverse complement sequence

TAAAGCTAGAGGATCTTTAGTCCGGGTTGGTATTATCAACTGGTACTAAAGATGTATTTTTAGTACCGGTTGATAACACTAATTTGGACTAAAAATATTC[C/T]
GGTACTAAAGATGTCTCCAGGATTAGTAAAAAAAAGCATTTGTATTCAAGTTAGATATGTGTAGTAGGTGGGATATGGTAATGCACGTGAGGGTTGAGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.60% 14.70% 0.15% 58.57% NA
All Indica  2759 43.00% 12.50% 0.04% 44.44% NA
All Japonica  1512 1.70% 9.00% 0.13% 89.22% NA
Aus  269 3.30% 62.80% 0.74% 33.09% NA
Indica I  595 33.60% 29.20% 0.00% 37.14% NA
Indica II  465 43.20% 2.20% 0.22% 54.41% NA
Indica III  913 48.30% 8.70% 0.00% 43.04% NA
Indica Intermediate  786 43.90% 10.40% 0.00% 45.67% NA
Temperate Japonica  767 1.00% 15.30% 0.26% 83.44% NA
Tropical Japonica  504 2.40% 2.40% 0.00% 95.24% NA
Japonica Intermediate  241 2.10% 2.90% 0.00% 95.02% NA
VI/Aromatic  96 3.10% 33.30% 2.08% 61.46% NA
Intermediate  90 34.40% 15.60% 0.00% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701665457 G -> DEL N N silent_mutation Average:10.843; most accessible tissue: Callus, score: 53.57 N N N N
vg0701665457 G -> A LOC_Os07g03960.1 upstream_gene_variant ; 3853.0bp to feature; MODIFIER silent_mutation Average:10.843; most accessible tissue: Callus, score: 53.57 N N N N
vg0701665457 G -> A LOC_Os07g03940.1 downstream_gene_variant ; 3190.0bp to feature; MODIFIER silent_mutation Average:10.843; most accessible tissue: Callus, score: 53.57 N N N N
vg0701665457 G -> A LOC_Os07g03950.1 downstream_gene_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:10.843; most accessible tissue: Callus, score: 53.57 N N N N
vg0701665457 G -> A LOC_Os07g03940-LOC_Os07g03950 intergenic_region ; MODIFIER silent_mutation Average:10.843; most accessible tissue: Callus, score: 53.57 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701665457 NA 3.02E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 3.95E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 6.30E-07 4.10E-07 mr1263 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 6.65E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 6.30E-07 4.10E-07 mr1451 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 2.17E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 8.43E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 5.53E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701665457 NA 1.03E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251