\
| Variant ID: vg0701665457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1665457 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.02, others allele: 0.00, population size: 55. )
ACCTCAACCCTCACGTGCATTACCATATCCCACCTACTACACATATCTAACTTGAATACAAATGCTTTTTTTTACTAATCCTGGAGACATCTTTAGTACC[G/A]
GAATATTTTTAGTCCAAATTAGTGTTATCAACCGGTACTAAAAATACATCTTTAGTACCAGTTGATAATACCAACCCGGACTAAAGATCCTCTAGCTTTA
TAAAGCTAGAGGATCTTTAGTCCGGGTTGGTATTATCAACTGGTACTAAAGATGTATTTTTAGTACCGGTTGATAACACTAATTTGGACTAAAAATATTC[C/T]
GGTACTAAAGATGTCTCCAGGATTAGTAAAAAAAAGCATTTGTATTCAAGTTAGATATGTGTAGTAGGTGGGATATGGTAATGCACGTGAGGGTTGAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.60% | 14.70% | 0.15% | 58.57% | NA |
| All Indica | 2759 | 43.00% | 12.50% | 0.04% | 44.44% | NA |
| All Japonica | 1512 | 1.70% | 9.00% | 0.13% | 89.22% | NA |
| Aus | 269 | 3.30% | 62.80% | 0.74% | 33.09% | NA |
| Indica I | 595 | 33.60% | 29.20% | 0.00% | 37.14% | NA |
| Indica II | 465 | 43.20% | 2.20% | 0.22% | 54.41% | NA |
| Indica III | 913 | 48.30% | 8.70% | 0.00% | 43.04% | NA |
| Indica Intermediate | 786 | 43.90% | 10.40% | 0.00% | 45.67% | NA |
| Temperate Japonica | 767 | 1.00% | 15.30% | 0.26% | 83.44% | NA |
| Tropical Japonica | 504 | 2.40% | 2.40% | 0.00% | 95.24% | NA |
| Japonica Intermediate | 241 | 2.10% | 2.90% | 0.00% | 95.02% | NA |
| VI/Aromatic | 96 | 3.10% | 33.30% | 2.08% | 61.46% | NA |
| Intermediate | 90 | 34.40% | 15.60% | 0.00% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701665457 | G -> DEL | N | N | silent_mutation | Average:10.843; most accessible tissue: Callus, score: 53.57 | N | N | N | N |
| vg0701665457 | G -> A | LOC_Os07g03960.1 | upstream_gene_variant ; 3853.0bp to feature; MODIFIER | silent_mutation | Average:10.843; most accessible tissue: Callus, score: 53.57 | N | N | N | N |
| vg0701665457 | G -> A | LOC_Os07g03940.1 | downstream_gene_variant ; 3190.0bp to feature; MODIFIER | silent_mutation | Average:10.843; most accessible tissue: Callus, score: 53.57 | N | N | N | N |
| vg0701665457 | G -> A | LOC_Os07g03950.1 | downstream_gene_variant ; 635.0bp to feature; MODIFIER | silent_mutation | Average:10.843; most accessible tissue: Callus, score: 53.57 | N | N | N | N |
| vg0701665457 | G -> A | LOC_Os07g03940-LOC_Os07g03950 | intergenic_region ; MODIFIER | silent_mutation | Average:10.843; most accessible tissue: Callus, score: 53.57 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701665457 | NA | 3.02E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 3.95E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | 6.30E-07 | 4.10E-07 | mr1263 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 6.65E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | 6.30E-07 | 4.10E-07 | mr1451 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 2.17E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 8.43E-08 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 5.53E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701665457 | NA | 1.03E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |