\
| Variant ID: vg0701643425 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1643425 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 209. )
TGCAAAGCTAGGTTATGACCTAGTCAGTTGGAGCATGTCCAGCTCACCATGGAAAATTCTAGGATTTAGGCCAAGACATGGTAGAAGCAGTCGGTAATTT[A/T]
CATCTCTTGGCTGCCATGAAGTCCAACAACATCGACATTAGGTGTTCGCCATTTTCTCGGAAAAGTTGCATCACTCCCATCTTGAAAATTGAAGATGTCA
TGACATCTTCAATTTTCAAGATGGGAGTGATGCAACTTTTCCGAGAAAATGGCGAACACCTAATGTCGATGTTGTTGGACTTCATGGCAGCCAAGAGATG[T/A]
AAATTACCGACTGCTTCTACCATGTCTTGGCCTAAATCCTAGAATTTTCCATGGTGAGCTGGACATGCTCCAACTGACTAGGTCATAACCTAGCTTTGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.90% | 9.90% | 0.34% | 57.85% | NA |
| All Indica | 2759 | 45.60% | 10.00% | 0.25% | 44.11% | NA |
| All Japonica | 1512 | 9.70% | 1.30% | 0.46% | 88.49% | NA |
| Aus | 269 | 4.50% | 62.80% | 0.00% | 32.71% | NA |
| Indica I | 595 | 35.50% | 26.40% | 0.50% | 37.65% | NA |
| Indica II | 465 | 43.90% | 1.30% | 0.22% | 54.62% | NA |
| Indica III | 913 | 53.20% | 4.20% | 0.11% | 42.50% | NA |
| Indica Intermediate | 786 | 45.50% | 9.50% | 0.25% | 44.66% | NA |
| Temperate Japonica | 767 | 15.10% | 1.70% | 0.65% | 82.53% | NA |
| Tropical Japonica | 504 | 4.00% | 1.20% | 0.40% | 94.44% | NA |
| Japonica Intermediate | 241 | 4.60% | 0.40% | 0.00% | 95.02% | NA |
| VI/Aromatic | 96 | 46.90% | 1.00% | 1.04% | 51.04% | NA |
| Intermediate | 90 | 48.90% | 3.30% | 1.11% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701643425 | A -> DEL | N | N | silent_mutation | Average:10.625; most accessible tissue: Callus, score: 57.376 | N | N | N | N |
| vg0701643425 | A -> T | LOC_Os07g03920.1 | upstream_gene_variant ; 173.0bp to feature; MODIFIER | silent_mutation | Average:10.625; most accessible tissue: Callus, score: 57.376 | N | N | N | N |
| vg0701643425 | A -> T | LOC_Os07g03910.1 | downstream_gene_variant ; 4815.0bp to feature; MODIFIER | silent_mutation | Average:10.625; most accessible tissue: Callus, score: 57.376 | N | N | N | N |
| vg0701643425 | A -> T | LOC_Os07g03930.1 | downstream_gene_variant ; 3588.0bp to feature; MODIFIER | silent_mutation | Average:10.625; most accessible tissue: Callus, score: 57.376 | N | N | N | N |
| vg0701643425 | A -> T | LOC_Os07g03920-LOC_Os07g03930 | intergenic_region ; MODIFIER | silent_mutation | Average:10.625; most accessible tissue: Callus, score: 57.376 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701643425 | NA | 5.23E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 9.50E-09 | mr1060 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 2.64E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 2.15E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 1.02E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 3.70E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 5.01E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 1.74E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 9.68E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 6.13E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701643425 | NA | 2.60E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |