\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701643425:

Variant ID: vg0701643425 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1643425
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAAAGCTAGGTTATGACCTAGTCAGTTGGAGCATGTCCAGCTCACCATGGAAAATTCTAGGATTTAGGCCAAGACATGGTAGAAGCAGTCGGTAATTT[A/T]
CATCTCTTGGCTGCCATGAAGTCCAACAACATCGACATTAGGTGTTCGCCATTTTCTCGGAAAAGTTGCATCACTCCCATCTTGAAAATTGAAGATGTCA

Reverse complement sequence

TGACATCTTCAATTTTCAAGATGGGAGTGATGCAACTTTTCCGAGAAAATGGCGAACACCTAATGTCGATGTTGTTGGACTTCATGGCAGCCAAGAGATG[T/A]
AAATTACCGACTGCTTCTACCATGTCTTGGCCTAAATCCTAGAATTTTCCATGGTGAGCTGGACATGCTCCAACTGACTAGGTCATAACCTAGCTTTGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.90% 9.90% 0.34% 57.85% NA
All Indica  2759 45.60% 10.00% 0.25% 44.11% NA
All Japonica  1512 9.70% 1.30% 0.46% 88.49% NA
Aus  269 4.50% 62.80% 0.00% 32.71% NA
Indica I  595 35.50% 26.40% 0.50% 37.65% NA
Indica II  465 43.90% 1.30% 0.22% 54.62% NA
Indica III  913 53.20% 4.20% 0.11% 42.50% NA
Indica Intermediate  786 45.50% 9.50% 0.25% 44.66% NA
Temperate Japonica  767 15.10% 1.70% 0.65% 82.53% NA
Tropical Japonica  504 4.00% 1.20% 0.40% 94.44% NA
Japonica Intermediate  241 4.60% 0.40% 0.00% 95.02% NA
VI/Aromatic  96 46.90% 1.00% 1.04% 51.04% NA
Intermediate  90 48.90% 3.30% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701643425 A -> DEL N N silent_mutation Average:10.625; most accessible tissue: Callus, score: 57.376 N N N N
vg0701643425 A -> T LOC_Os07g03920.1 upstream_gene_variant ; 173.0bp to feature; MODIFIER silent_mutation Average:10.625; most accessible tissue: Callus, score: 57.376 N N N N
vg0701643425 A -> T LOC_Os07g03910.1 downstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:10.625; most accessible tissue: Callus, score: 57.376 N N N N
vg0701643425 A -> T LOC_Os07g03930.1 downstream_gene_variant ; 3588.0bp to feature; MODIFIER silent_mutation Average:10.625; most accessible tissue: Callus, score: 57.376 N N N N
vg0701643425 A -> T LOC_Os07g03920-LOC_Os07g03930 intergenic_region ; MODIFIER silent_mutation Average:10.625; most accessible tissue: Callus, score: 57.376 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701643425 NA 5.23E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 9.50E-09 mr1060 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 2.64E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 2.15E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 1.02E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 3.70E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 5.01E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 1.74E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 9.68E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 6.13E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701643425 NA 2.60E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251