\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701559521:

Variant ID: vg0701559521 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1559521
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ACGACTACTACTTCATTCAATTAGCTGGAATATATAGTCCTCCCTTGTATTATGTCGCGTACTTAATTTTTTTTCTGAGAATAAATAGTGTCGAAATGCC[T/C]
TAATATTTTCAGTCGGGACGAGAGGCCAGCTAAATTTTATTCGTAAAAAATGAAGGAAATTAAACGTATCACACTGATAAACCCTAGTATATCTGTTCCA

Reverse complement sequence

TGGAACAGATATACTAGGGTTTATCAGTGTGATACGTTTAATTTCCTTCATTTTTTACGAATAAAATTTAGCTGGCCTCTCGTCCCGACTGAAAATATTA[A/G]
GGCATTTCGACACTATTTATTCTCAGAAAAAAAATTAAGTACGCGACATAATACAAGGGAGGACTATATATTCCAGCTAATTGAATGAAGTAGTAGTCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.20% 0.02% 0.00% NA
All Indica  2759 86.30% 13.70% 0.00% 0.00% NA
All Japonica  1512 3.80% 96.20% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 46.90% 53.10% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 86.90% 13.10% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701559521 T -> C LOC_Os07g03760-LOC_Os07g03770 intergenic_region ; MODIFIER silent_mutation Average:44.234; most accessible tissue: Callus, score: 80.041 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701559521 NA 3.64E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.93E-19 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.50E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.48E-19 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.43E-21 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.14E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 5.94E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.38E-18 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.25E-19 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.13E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.96E-16 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.75E-18 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.17E-19 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.31E-22 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.32E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.84E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 4.04E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 3.43E-25 mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.74E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 7.85E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.73E-08 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 8.08E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 5.09E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 7.53E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 2.67E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 3.75E-18 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 1.88E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 4.55E-17 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701559521 NA 4.85E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251