Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701536569:

Variant ID: vg0701536569 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1536569
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTGCAATAATGGTTGCAGCGGCCATGGCGCAGAACTCGGCGCAGGACTTCGTAACCCGCACAACGCGGCGAGGTCCGACGTCGGGGTGGGGCCGGTG[A/C]
GCTGGGACGACACGGTGGCGGCGTACGCGGAGAGCTACGCGGCGCAGCGGCAGGGCGACTGCGCGCTGGAGCACTCGGACTCCGGCGGGAAGTACGGCGA

Reverse complement sequence

TCGCCGTACTTCCCGCCGGAGTCCGAGTGCTCCAGCGCGCAGTCGCCCTGCCGCTGCGCCGCGTAGCTCTCCGCGTACGCCGCCACCGTGTCGTCCCAGC[T/G]
CACCGGCCCCACCCCGACGTCGGACCTCGCCGCGTTGTGCGGGTTACGAAGTCCTGCGCCGAGTTCTGCGCCATGGCCGCTGCAACCATTATTGCAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.00%	41.00%	1.12%	8.87%	NA
All Indica	2759	74.80%	14.90%	1.52%	8.74%	NA
All Japonica	1512	3.00%	96.40%	0.07%	0.60%	NA
Aus	269	32.00%	4.50%	2.23%	61.34%	NA
Indica I	595	82.00%	5.90%	2.35%	9.75%	NA
Indica II	465	40.90%	55.10%	1.94%	2.15%	NA
Indica III	913	88.00%	0.80%	0.77%	10.51%	NA
Indica Intermediate	786	74.30%	14.40%	1.53%	9.80%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.20%	93.50%	0.20%	0.20%	NA
Japonica Intermediate	241	3.30%	93.40%	0.00%	3.32%	NA
VI/Aromatic	96	90.60%	8.30%	0.00%	1.04%	NA
Intermediate	90	37.80%	54.40%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701536569	A -> DEL	LOC_Os07g03740.1	N	splice_acceptor_variant	Average:66.639; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0701536569	A -> C	LOC_Os07g03740.1	splice_acceptor_variant&intron_variant ; HIGH	splice_acceptor_variant	Average:66.639; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701536569	NA	3.34E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	8.16E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.11E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	8.03E-07	mr1796	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.61E-08	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	3.73E-06	mr1990	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	3.32E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	3.02E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	3.36E-06	3.36E-06	mr1126_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.62E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.97E-21	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	4.58E-06	mr1185_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.94E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.45E-07	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.46E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	4.66E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	2.10E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	2.22E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	6.72E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	2.63E-09	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	3.70E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	4.04E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	3.66E-08	mr1677_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.06E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	5.39E-06	mr1704_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	2.54E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	5.58E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.54E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569	NA	1.34E-16	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251