\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701536569:

Variant ID: vg0701536569 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1536569
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTGCAATAATGGTTGCAGCGGCCATGGCGCAGAACTCGGCGCAGGACTTCGTAACCCGCACAACGCGGCGAGGTCCGACGTCGGGGTGGGGCCGGTG[A/C]
GCTGGGACGACACGGTGGCGGCGTACGCGGAGAGCTACGCGGCGCAGCGGCAGGGCGACTGCGCGCTGGAGCACTCGGACTCCGGCGGGAAGTACGGCGA

Reverse complement sequence

TCGCCGTACTTCCCGCCGGAGTCCGAGTGCTCCAGCGCGCAGTCGCCCTGCCGCTGCGCCGCGTAGCTCTCCGCGTACGCCGCCACCGTGTCGTCCCAGC[T/G]
CACCGGCCCCACCCCGACGTCGGACCTCGCCGCGTTGTGCGGGTTACGAAGTCCTGCGCCGAGTTCTGCGCCATGGCCGCTGCAACCATTATTGCAGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 41.00% 1.12% 8.87% NA
All Indica  2759 74.80% 14.90% 1.52% 8.74% NA
All Japonica  1512 3.00% 96.40% 0.07% 0.60% NA
Aus  269 32.00% 4.50% 2.23% 61.34% NA
Indica I  595 82.00% 5.90% 2.35% 9.75% NA
Indica II  465 40.90% 55.10% 1.94% 2.15% NA
Indica III  913 88.00% 0.80% 0.77% 10.51% NA
Indica Intermediate  786 74.30% 14.40% 1.53% 9.80% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.50% 0.20% 0.20% NA
Japonica Intermediate  241 3.30% 93.40% 0.00% 3.32% NA
VI/Aromatic  96 90.60% 8.30% 0.00% 1.04% NA
Intermediate  90 37.80% 54.40% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701536569 A -> DEL LOC_Os07g03740.1 N splice_acceptor_variant Average:66.639; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0701536569 A -> C LOC_Os07g03740.1 splice_acceptor_variant&intron_variant ; HIGH splice_acceptor_variant Average:66.639; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701536569 NA 3.34E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 8.16E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.11E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 8.03E-07 mr1796 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.61E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 3.73E-06 mr1990 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 3.32E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 3.02E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 3.36E-06 3.36E-06 mr1126_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.62E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.97E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 4.58E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.94E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.45E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.46E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 4.66E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 2.10E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 2.22E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 6.72E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 2.63E-09 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 3.70E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 4.04E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 3.66E-08 mr1677_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.06E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 5.39E-06 mr1704_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 2.54E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 5.58E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.54E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536569 NA 1.34E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251