\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701530157:

Variant ID: vg0701530157 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1530157
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGGCTGGCGTGGTCAAGGTGGGGGCGGCGAGCTGGCGCGCGGCGCCAGGGCGCTCGCGGTCCATGGCGCTAGGGGCTAGGCGATGGATGCAGGGCAC[T/A]
GGTTCGGGAAAGGAAAAAGGGAAAAGAAGGGGGAAAAAGGGGAGCTTGACCATGCCGGTTTGGGAGAAGGAGGTGGGAGAGGGAGAGCAGCTGCTTCTCC

Reverse complement sequence

GGAGAAGCAGCTGCTCTCCCTCTCCCACCTCCTTCTCCCAAACCGGCATGGTCAAGCTCCCCTTTTTCCCCCTTCTTTTCCCTTTTTCCTTTCCCGAACC[A/T]
GTGCCCTGCATCCATCGCCTAGCCCCTAGCGCCATGGACCGCGAGCGCCCTGGCGCCGCGCGCCAGCTCGCCGCCCCCACCTTGACCACGCCAGCCCGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 4.30% 5.08% 49.09% NA
All Indica  2759 15.40% 7.00% 5.15% 72.53% NA
All Japonica  1512 97.10% 0.00% 0.60% 2.31% NA
Aus  269 4.80% 3.30% 11.15% 80.67% NA
Indica I  595 6.40% 3.70% 3.53% 86.39% NA
Indica II  465 55.30% 2.80% 1.72% 40.22% NA
Indica III  913 1.10% 13.90% 7.78% 77.22% NA
Indica Intermediate  786 15.10% 3.80% 5.34% 75.70% NA
Temperate Japonica  767 99.30% 0.00% 0.13% 0.52% NA
Tropical Japonica  504 93.70% 0.00% 0.60% 5.75% NA
Japonica Intermediate  241 97.10% 0.00% 2.07% 0.83% NA
VI/Aromatic  96 7.30% 1.00% 53.12% 38.54% NA
Intermediate  90 57.80% 0.00% 8.89% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701530157 T -> DEL LOC_Os07g03740.1 N frameshift_variant Average:59.414; most accessible tissue: Minghui63 flower, score: 97.259 N N N N
vg0701530157 T -> A LOC_Os07g03740.1 synonymous_variant ; p.Thr84Thr; LOW synonymous_codon Average:59.414; most accessible tissue: Minghui63 flower, score: 97.259 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0701530157 T A 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701530157 4.37E-06 4.37E-06 mr1666 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701530157 NA 2.35E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701530157 NA 6.78E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701530157 NA 7.07E-06 mr1796 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251