RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0701498071:

Variant ID: vg0701498071 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1498071
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.09, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGAATAAGACGAGTGGTCAAACGTTACAAGCAAAAAGTCAAAATCCCTTATATTATTGGATAGAGAGAGTATAAGCTAATTAAGTGGGAAATCTACA[G/T]
GTCAACCCATTTAATTAGCATATAATTGGGTTTTCTGCTCGATCCACTTGGACTTTTGAAACCAGTCAAGTTAATTTGTGCCTGCAGTTGATTCACTTTT

Reverse complement sequence

AAAAGTGAATCAACTGCAGGCACAAATTAACTTGACTGGTTTCAAAAGTCCAAGTGGATCGAGCAGAAAACCCAATTATATGCTAATTAAATGGGTTGAC[C/A]
TGTAGATTTCCCACTTAATTAGCTTATACTCTCTCTATCCAATAATATAAGGGATTTTGACTTTTTGCTTGTAACGTTTGACCACTCGTCTTATTCAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	41.30%	0.19%	0.00%	NA
All Indica	2759	33.30%	66.40%	0.22%	0.00%	NA
All Japonica	1512	97.20%	2.60%	0.13%	0.00%	NA
Aus	269	84.00%	16.00%	0.00%	0.00%	NA
Indica I	595	6.90%	93.10%	0.00%	0.00%	NA
Indica II	465	84.70%	14.80%	0.43%	0.00%	NA
Indica III	913	19.90%	80.00%	0.11%	0.00%	NA
Indica Intermediate	786	38.50%	61.10%	0.38%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	93.50%	6.30%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701498071	G -> T	LOC_Os07g03690.1	upstream_gene_variant ; 2469.0bp to feature; MODIFIER	silent_mutation	Average:29.013; most accessible tissue: Callus, score: 55.121	N	N	N	N
vg0701498071	G -> T	LOC_Os07g03680.1	downstream_gene_variant ; 723.0bp to feature; MODIFIER	silent_mutation	Average:29.013; most accessible tissue: Callus, score: 55.121	N	N	N	N
vg0701498071	G -> T	LOC_Os07g03680-LOC_Os07g03690	intergenic_region ; MODIFIER	silent_mutation	Average:29.013; most accessible tissue: Callus, score: 55.121	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701498071	NA	7.48E-13	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701498071	NA	2.86E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701498071	NA	7.77E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	1.30E-13	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	3.89E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	3.37E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	1.24E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	6.42E-07	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	1.02E-07	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701498071	NA	7.25E-07	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 44 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0701498071:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact