\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701481335:

Variant ID: vg0701481335 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1481335
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAATTCAAAATTTTAATTGATAAAAAAAGTCACAATAAAAAATGGCCAAAATAATAGCAGTAAGAACACAATAACATGATAGAGCATGATTTTAGAAA[T/C]
ATTTAGAAAAAAGAATCATCTAATTTAGAGTTCATATAAGTGAGATACACTAGTTTCAAATTTTATTTTTGCATACGGCTCCTTAAGTAGCCCGTATGGA

Reverse complement sequence

TCCATACGGGCTACTTAAGGAGCCGTATGCAAAAATAAAATTTGAAACTAGTGTATCTCACTTATATGAACTCTAAATTAGATGATTCTTTTTTCTAAAT[A/G]
TTTCTAAAATCATGCTCTATCATGTTATTGTGTTCTTACTGCTATTATTTTGGCCATTTTTTATTGTGACTTTTTTTATCAATTAAAATTTTGAATTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 35.00% 6.92% 12.42% NA
All Indica  2759 67.70% 21.80% 5.40% 5.04% NA
All Japonica  1512 4.30% 58.20% 8.27% 29.23% NA
Aus  269 39.00% 44.60% 15.24% 1.12% NA
Indica I  595 92.90% 6.10% 0.67% 0.34% NA
Indica II  465 15.70% 45.60% 16.99% 21.72% NA
Indica III  913 81.70% 16.00% 1.97% 0.33% NA
Indica Intermediate  786 63.20% 26.50% 6.11% 4.20% NA
Temperate Japonica  767 1.70% 79.90% 4.82% 13.56% NA
Tropical Japonica  504 8.30% 29.00% 12.50% 50.20% NA
Japonica Intermediate  241 4.10% 50.20% 10.37% 35.27% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 41.10% 43.30% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701481335 T -> DEL N N silent_mutation Average:13.881; most accessible tissue: Callus, score: 24.617 N N N N
vg0701481335 T -> C LOC_Os07g03650.1 upstream_gene_variant ; 3136.0bp to feature; MODIFIER silent_mutation Average:13.881; most accessible tissue: Callus, score: 24.617 N N N N
vg0701481335 T -> C LOC_Os07g03670.1 upstream_gene_variant ; 4319.0bp to feature; MODIFIER silent_mutation Average:13.881; most accessible tissue: Callus, score: 24.617 N N N N
vg0701481335 T -> C LOC_Os07g03640.1 downstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:13.881; most accessible tissue: Callus, score: 24.617 N N N N
vg0701481335 T -> C LOC_Os07g03650-LOC_Os07g03670 intergenic_region ; MODIFIER silent_mutation Average:13.881; most accessible tissue: Callus, score: 24.617 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701481335 NA 7.09E-06 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335 NA 4.77E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335 NA 9.00E-06 mr1786 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335 1.73E-06 1.53E-06 mr1797 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701481335 1.73E-06 1.53E-06 mr1801 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251