\
| Variant ID: vg0701479081 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1479081 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAACTTGGGAAATGGGTTTGAAAAGCCTTGAAAACCTGACATGTGGTGTCGGCATGTTTGAAAATAAAATAAATTGTGAAAACTCGCGATGCGGGGGTT[A/G]
TGCCTGTGTGGCACTGTCCCGTATTCGCATATAAGGACCGATTCCTGTGGGAAATTCATCCGAGCATATAACAAGTGCGACCACACGGGTGCAATGGGAC
GTCCCATTGCACCCGTGTGGTCGCACTTGTTATATGCTCGGATGAATTTCCCACAGGAATCGGTCCTTATATGCGAATACGGGACAGTGCCACACAGGCA[T/C]
AACCCCCGCATCGCGAGTTTTCACAATTTATTTTATTTTCAAACATGCCGACACCACATGTCAGGTTTTCAAGGCTTTTCAAACCCATTTCCCAAGTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.60% | 17.20% | 1.18% | 36.03% | NA |
| All Indica | 2759 | 68.00% | 3.60% | 0.29% | 28.16% | NA |
| All Japonica | 1512 | 4.00% | 45.20% | 2.84% | 47.95% | NA |
| Aus | 269 | 36.10% | 0.70% | 0.37% | 62.83% | NA |
| Indica I | 595 | 93.10% | 6.20% | 0.00% | 0.67% | NA |
| Indica II | 465 | 16.10% | 4.50% | 0.43% | 78.92% | NA |
| Indica III | 913 | 81.80% | 0.50% | 0.11% | 17.52% | NA |
| Indica Intermediate | 786 | 63.60% | 4.50% | 0.64% | 31.30% | NA |
| Temperate Japonica | 767 | 1.80% | 77.10% | 5.22% | 15.91% | NA |
| Tropical Japonica | 504 | 7.50% | 4.20% | 0.20% | 88.10% | NA |
| Japonica Intermediate | 241 | 3.70% | 29.50% | 0.83% | 65.98% | NA |
| VI/Aromatic | 96 | 86.50% | 4.20% | 4.17% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 28.90% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701479081 | A -> DEL | N | N | silent_mutation | Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0701479081 | A -> G | LOC_Os07g03650.1 | upstream_gene_variant ; 882.0bp to feature; MODIFIER | silent_mutation | Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0701479081 | A -> G | LOC_Os07g03640.1 | downstream_gene_variant ; 2364.0bp to feature; MODIFIER | silent_mutation | Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0701479081 | A -> G | LOC_Os07g03650-LOC_Os07g03670 | intergenic_region ; MODIFIER | silent_mutation | Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701479081 | NA | 4.87E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 2.56E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 1.23E-06 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | 4.46E-06 | 4.46E-06 | mr1144 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 9.67E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 2.38E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 4.13E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 2.16E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701479081 | NA | 9.50E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |