Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701479081:

Variant ID: vg0701479081 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1479081
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAACTTGGGAAATGGGTTTGAAAAGCCTTGAAAACCTGACATGTGGTGTCGGCATGTTTGAAAATAAAATAAATTGTGAAAACTCGCGATGCGGGGGTT[A/G]
TGCCTGTGTGGCACTGTCCCGTATTCGCATATAAGGACCGATTCCTGTGGGAAATTCATCCGAGCATATAACAAGTGCGACCACACGGGTGCAATGGGAC

Reverse complement sequence

GTCCCATTGCACCCGTGTGGTCGCACTTGTTATATGCTCGGATGAATTTCCCACAGGAATCGGTCCTTATATGCGAATACGGGACAGTGCCACACAGGCA[T/C]
AACCCCCGCATCGCGAGTTTTCACAATTTATTTTATTTTCAAACATGCCGACACCACATGTCAGGTTTTCAAGGCTTTTCAAACCCATTTCCCAAGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.60%	17.20%	1.18%	36.03%	NA
All Indica	2759	68.00%	3.60%	0.29%	28.16%	NA
All Japonica	1512	4.00%	45.20%	2.84%	47.95%	NA
Aus	269	36.10%	0.70%	0.37%	62.83%	NA
Indica I	595	93.10%	6.20%	0.00%	0.67%	NA
Indica II	465	16.10%	4.50%	0.43%	78.92%	NA
Indica III	913	81.80%	0.50%	0.11%	17.52%	NA
Indica Intermediate	786	63.60%	4.50%	0.64%	31.30%	NA
Temperate Japonica	767	1.80%	77.10%	5.22%	15.91%	NA
Tropical Japonica	504	7.50%	4.20%	0.20%	88.10%	NA
Japonica Intermediate	241	3.70%	29.50%	0.83%	65.98%	NA
VI/Aromatic	96	86.50%	4.20%	4.17%	5.21%	NA
Intermediate	90	41.10%	28.90%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701479081	A -> DEL	N	N	silent_mutation	Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0701479081	A -> G	LOC_Os07g03650.1	upstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0701479081	A -> G	LOC_Os07g03640.1	downstream_gene_variant ; 2364.0bp to feature; MODIFIER	silent_mutation	Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0701479081	A -> G	LOC_Os07g03650-LOC_Os07g03670	intergenic_region ; MODIFIER	silent_mutation	Average:15.963; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701479081	NA	4.87E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	2.56E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	1.23E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	4.46E-06	4.46E-06	mr1144	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	9.67E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	2.38E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	4.13E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	2.16E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701479081	NA	9.50E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251