\
| Variant ID: vg0701270264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1270264 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )
CAAGTTCATAACAACGTTTGAAAATTTAAATTTTTCCCGTGAGGCCGTGATAAACTGGGCGATTTTACCAAAAATAAATATTGCTACTGTCCCTTCTACC[T/G]
AAAGTGAACCATCTTTCCAAATAATCATCATATCAGCTTTGAATTGATCTACCCTTGTTCTTAACGTATACTGGCCTCTAACTTTTCGCATATGTTTATG
CATAAACATATGCGAAAAGTTAGAGGCCAGTATACGTTAAGAACAAGGGTAGATCAATTCAAAGCTGATATGATGATTATTTGGAAAGATGGTTCACTTT[A/C]
GGTAGAAGGGACAGTAGCAATATTTATTTTTGGTAAAATCGCCCAGTTTATCACGGCCTCACGGGAAAAATTTAAATTTTCAAACGTTGTTATGAACTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.20% | 0.10% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.30% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.70% | 0.00% | 6.32% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701270264 | T -> G | LOC_Os07g03210.1 | upstream_gene_variant ; 4814.0bp to feature; MODIFIER | silent_mutation | Average:39.71; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270264 | T -> G | LOC_Os07g03230.1 | upstream_gene_variant ; 4291.0bp to feature; MODIFIER | silent_mutation | Average:39.71; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270264 | T -> G | LOC_Os07g03230.2 | upstream_gene_variant ; 4291.0bp to feature; MODIFIER | silent_mutation | Average:39.71; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270264 | T -> G | LOC_Os07g03220.1 | downstream_gene_variant ; 1714.0bp to feature; MODIFIER | silent_mutation | Average:39.71; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270264 | T -> G | LOC_Os07g03220-LOC_Os07g03230 | intergenic_region ; MODIFIER | silent_mutation | Average:39.71; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701270264 | NA | 5.54E-10 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 5.95E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 1.36E-09 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 3.86E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 6.95E-09 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 5.67E-09 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 1.22E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | 7.62E-07 | 7.58E-07 | mr1197_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 5.54E-06 | mr1197_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 2.64E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 1.47E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 9.46E-08 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270264 | NA | 1.44E-09 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |