\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701270264:

Variant ID: vg0701270264 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1270264
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTTCATAACAACGTTTGAAAATTTAAATTTTTCCCGTGAGGCCGTGATAAACTGGGCGATTTTACCAAAAATAAATATTGCTACTGTCCCTTCTACC[T/G]
AAAGTGAACCATCTTTCCAAATAATCATCATATCAGCTTTGAATTGATCTACCCTTGTTCTTAACGTATACTGGCCTCTAACTTTTCGCATATGTTTATG

Reverse complement sequence

CATAAACATATGCGAAAAGTTAGAGGCCAGTATACGTTAAGAACAAGGGTAGATCAATTCAAAGCTGATATGATGATTATTTGGAAAGATGGTTCACTTT[A/C]
GGTAGAAGGGACAGTAGCAATATTTATTTTTGGTAAAATCGCCCAGTTTATCACGGCCTCACGGGAAAAATTTAAATTTTCAAACGTTGTTATGAACTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.20% 0.10% 0.68% 0.00% NA
All Indica  2759 99.20% 0.30% 0.51% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 93.70% 0.00% 6.32% 0.00% NA
Indica I  595 98.80% 0.20% 1.01% 0.00% NA
Indica II  465 99.10% 0.20% 0.65% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701270264 T -> G LOC_Os07g03210.1 upstream_gene_variant ; 4814.0bp to feature; MODIFIER silent_mutation Average:39.71; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270264 T -> G LOC_Os07g03230.1 upstream_gene_variant ; 4291.0bp to feature; MODIFIER silent_mutation Average:39.71; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270264 T -> G LOC_Os07g03230.2 upstream_gene_variant ; 4291.0bp to feature; MODIFIER silent_mutation Average:39.71; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270264 T -> G LOC_Os07g03220.1 downstream_gene_variant ; 1714.0bp to feature; MODIFIER silent_mutation Average:39.71; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270264 T -> G LOC_Os07g03220-LOC_Os07g03230 intergenic_region ; MODIFIER silent_mutation Average:39.71; most accessible tissue: Callus, score: 88.717 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701270264 NA 5.54E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 5.95E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 1.36E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 3.86E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 6.95E-09 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 5.67E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 1.22E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 7.62E-07 7.58E-07 mr1197_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 5.54E-06 mr1197_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 2.64E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 1.47E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 9.46E-08 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270264 NA 1.44E-09 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251