\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701270194:

Variant ID: vg0701270194 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1270194
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTATATTTGTGTTCTTAAGAAATTATTAGAATCAAATGTTGAAAACTAGGTTATATTAAATAAAATTACAAGTTCATAACAACGTTTGAAAATTTAAA[T/A]
TTTTCCCGTGAGGCCGTGATAAACTGGGCGATTTTACCAAAAATAAATATTGCTACTGTCCCTTCTACCTAAAGTGAACCATCTTTCCAAATAATCATCA

Reverse complement sequence

TGATGATTATTTGGAAAGATGGTTCACTTTAGGTAGAAGGGACAGTAGCAATATTTATTTTTGGTAAAATCGCCCAGTTTATCACGGCCTCACGGGAAAA[A/T]
TTTAAATTTTCAAACGTTGTTATGAACTTGTAATTTTATTTAATATAACCTAGTTTTCAACATTTGATTCTAATAATTTCTTAAGAACACAAATATAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.60% 0.00% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 81.00% 19.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 68.80% 31.20% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701270194 T -> A LOC_Os07g03210.1 upstream_gene_variant ; 4744.0bp to feature; MODIFIER silent_mutation Average:57.99; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270194 T -> A LOC_Os07g03230.1 upstream_gene_variant ; 4361.0bp to feature; MODIFIER silent_mutation Average:57.99; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270194 T -> A LOC_Os07g03230.2 upstream_gene_variant ; 4361.0bp to feature; MODIFIER silent_mutation Average:57.99; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270194 T -> A LOC_Os07g03220.1 downstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:57.99; most accessible tissue: Callus, score: 88.717 N N N N
vg0701270194 T -> A LOC_Os07g03220-LOC_Os07g03230 intergenic_region ; MODIFIER silent_mutation Average:57.99; most accessible tissue: Callus, score: 88.717 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701270194 4.40E-09 NA mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 6.53E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 NA 3.06E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 NA 1.37E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 6.26E-08 NA mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 1.40E-09 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 NA 6.34E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194 1.54E-06 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251