\
| Variant ID: vg0701270194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1270194 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTATATTTGTGTTCTTAAGAAATTATTAGAATCAAATGTTGAAAACTAGGTTATATTAAATAAAATTACAAGTTCATAACAACGTTTGAAAATTTAAA[T/A]
TTTTCCCGTGAGGCCGTGATAAACTGGGCGATTTTACCAAAAATAAATATTGCTACTGTCCCTTCTACCTAAAGTGAACCATCTTTCCAAATAATCATCA
TGATGATTATTTGGAAAGATGGTTCACTTTAGGTAGAAGGGACAGTAGCAATATTTATTTTTGGTAAAATCGCCCAGTTTATCACGGCCTCACGGGAAAA[A/T]
TTTAAATTTTCAAACGTTGTTATGAACTTGTAATTTTATTTAATATAACCTAGTTTTCAACATTTGATTCTAATAATTTCTTAAGAACACAAATATAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701270194 | T -> A | LOC_Os07g03210.1 | upstream_gene_variant ; 4744.0bp to feature; MODIFIER | silent_mutation | Average:57.99; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270194 | T -> A | LOC_Os07g03230.1 | upstream_gene_variant ; 4361.0bp to feature; MODIFIER | silent_mutation | Average:57.99; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270194 | T -> A | LOC_Os07g03230.2 | upstream_gene_variant ; 4361.0bp to feature; MODIFIER | silent_mutation | Average:57.99; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270194 | T -> A | LOC_Os07g03220.1 | downstream_gene_variant ; 1644.0bp to feature; MODIFIER | silent_mutation | Average:57.99; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| vg0701270194 | T -> A | LOC_Os07g03220-LOC_Os07g03230 | intergenic_region ; MODIFIER | silent_mutation | Average:57.99; most accessible tissue: Callus, score: 88.717 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701270194 | 4.40E-09 | NA | mr1137 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | 6.53E-06 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | NA | 3.06E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | NA | 1.37E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | 6.26E-08 | NA | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | 1.40E-09 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | NA | 6.34E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701270194 | 1.54E-06 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |