Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0701270194:

Variant ID: vg0701270194 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1270194
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTATATTTGTGTTCTTAAGAAATTATTAGAATCAAATGTTGAAAACTAGGTTATATTAAATAAAATTACAAGTTCATAACAACGTTTGAAAATTTAAA[T/A]
TTTTCCCGTGAGGCCGTGATAAACTGGGCGATTTTACCAAAAATAAATATTGCTACTGTCCCTTCTACCTAAAGTGAACCATCTTTCCAAATAATCATCA

Reverse complement sequence

TGATGATTATTTGGAAAGATGGTTCACTTTAGGTAGAAGGGACAGTAGCAATATTTATTTTTGGTAAAATCGCCCAGTTTATCACGGCCTCACGGGAAAA[A/T]
TTTAAATTTTCAAACGTTGTTATGAACTTGTAATTTTATTTAATATAACCTAGTTTTCAACATTTGATTCTAATAATTTCTTAAGAACACAAATATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	6.60%	0.00%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	81.00%	19.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	68.80%	31.20%	0.00%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701270194	T -> A	LOC_Os07g03210.1	upstream_gene_variant ; 4744.0bp to feature; MODIFIER	silent_mutation	Average:57.99; most accessible tissue: Callus, score: 88.717	N	N	N	N
vg0701270194	T -> A	LOC_Os07g03230.1	upstream_gene_variant ; 4361.0bp to feature; MODIFIER	silent_mutation	Average:57.99; most accessible tissue: Callus, score: 88.717	N	N	N	N
vg0701270194	T -> A	LOC_Os07g03230.2	upstream_gene_variant ; 4361.0bp to feature; MODIFIER	silent_mutation	Average:57.99; most accessible tissue: Callus, score: 88.717	N	N	N	N
vg0701270194	T -> A	LOC_Os07g03220.1	downstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:57.99; most accessible tissue: Callus, score: 88.717	N	N	N	N
vg0701270194	T -> A	LOC_Os07g03220-LOC_Os07g03230	intergenic_region ; MODIFIER	silent_mutation	Average:57.99; most accessible tissue: Callus, score: 88.717	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701270194	4.40E-09	NA	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	6.53E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	NA	3.06E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	NA	1.37E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	6.26E-08	NA	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	1.40E-09	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	NA	6.34E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701270194	1.54E-06	NA	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251