\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701224067:

Variant ID: vg0701224067 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1224067
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGGTGGCGGCCACTCCCTTCTAGAGATTGGACGGAGGAGGCTGCCCCCCAATGCCACGTGGCCCTCCCTCGAGGGGGATCGGGTCCGAGGTAGGGCGG[T/C]
GGCCACTCCCTGGCCGAGACTAGAGGGAAAAGGATGCCCTAGGCGCCACGTGGCCCTCCCCCGAGGGGGGATCGGGCCGCCTGAGGTCGGGCGGCGGCCG

Reverse complement sequence

CGGCCGCCGCCCGACCTCAGGCGGCCCGATCCCCCCTCGGGGGAGGGCCACGTGGCGCCTAGGGCATCCTTTTCCCTCTAGTCTCGGCCAGGGAGTGGCC[A/G]
CCGCCCTACCTCGGACCCGATCCCCCTCGAGGGAGGGCCACGTGGCATTGGGGGGCAGCCTCCTCCGTCCAATCTCTAGAAGGGAGTGGCCGCCACCCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 0.60% 5.52% 1.02% NA
All Indica  2759 95.10% 0.10% 3.33% 1.45% NA
All Japonica  1512 99.70% 0.00% 0.13% 0.13% NA
Aus  269 28.30% 9.30% 60.22% 2.23% NA
Indica I  595 90.40% 0.00% 6.55% 3.03% NA
Indica II  465 99.60% 0.00% 0.22% 0.22% NA
Indica III  913 95.20% 0.10% 3.07% 1.64% NA
Indica Intermediate  786 95.90% 0.30% 3.05% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701224067 T -> DEL N N silent_mutation Average:56.809; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0701224067 T -> C LOC_Os07g03160.1 downstream_gene_variant ; 4804.0bp to feature; MODIFIER silent_mutation Average:56.809; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0701224067 T -> C LOC_Os07g03150-LOC_Os07g03160 intergenic_region ; MODIFIER silent_mutation Average:56.809; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701224067 NA 3.55E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 4.24E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 4.97E-07 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 6.25E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 2.28E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 2.98E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 1.16E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 4.75E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 3.65E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 2.78E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 1.69E-42 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 1.60E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 4.94E-09 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 1.99E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 6.39E-06 NA mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 3.74E-30 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 2.19E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701224067 NA 1.16E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251