\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701188868:

Variant ID: vg0701188868 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1188868
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTACAAATATAAATTTAGTTATATAGGACTGTAATTTTATATTTCTGAGAGAAACGATGTCTCTCACCGATCAGTGTTGGCCGTGCTACCGGCGGCT[G/A]
GCGGTCAAAGGCCACCGTGTCATCGTGCTTCTCCGACACGGTGGCCGACGTGCTGGTGTCCGACGCGCCGGCTGACGAGCCTGAAAAAAAAGGTGAAATG

Reverse complement sequence

CATTTCACCTTTTTTTTCAGGCTCGTCAGCCGGCGCGTCGGACACCAGCACGTCGGCCACCGTGTCGGAGAAGCACGATGACACGGTGGCCTTTGACCGC[C/T]
AGCCGCCGGTAGCACGGCCAACACTGATCGGTGAGAGACATCGTTTCTCTCAGAAATATAAAATTACAGTCCTATATAACTAAATTTATATTTGTAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.30% 7.20% 15.64% 2.90% NA
All Indica  2759 69.60% 0.30% 25.37% 4.78% NA
All Japonica  1512 85.60% 12.50% 1.65% 0.26% NA
Aus  269 77.30% 19.30% 3.35% 0.00% NA
Indica I  595 42.50% 0.80% 50.76% 5.88% NA
Indica II  465 91.60% 0.00% 6.67% 1.72% NA
Indica III  913 75.10% 0.00% 19.28% 5.59% NA
Indica Intermediate  786 70.50% 0.40% 24.30% 4.83% NA
Temperate Japonica  767 79.50% 19.90% 0.52% 0.00% NA
Tropical Japonica  504 90.10% 5.40% 3.77% 0.79% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 83.30% 11.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701188868 G -> DEL N N silent_mutation Average:86.372; most accessible tissue: Zhenshan97 panicle, score: 96.452 N N N N
vg0701188868 G -> A LOC_Os07g03110.1 upstream_gene_variant ; 3202.0bp to feature; MODIFIER silent_mutation Average:86.372; most accessible tissue: Zhenshan97 panicle, score: 96.452 N N N N
vg0701188868 G -> A LOC_Os07g03110-LOC_Os07g03120 intergenic_region ; MODIFIER silent_mutation Average:86.372; most accessible tissue: Zhenshan97 panicle, score: 96.452 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0701188868 G A 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701188868 NA 1.18E-23 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701188868 NA 1.85E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 NA 2.48E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 NA 1.21E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 NA 1.59E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 3.17E-06 2.02E-08 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 4.27E-06 1.01E-06 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 2.55E-06 2.54E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 NA 2.69E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701188868 6.80E-06 NA mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251