\
| Variant ID: vg0701179040 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1179040 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.15, others allele: 0.00, population size: 107. )
ATATGACATCGCTGATTTTTTTTATACGTTTAACTATTCGTTTTATTCAAAAAATTTTATATGCTTATCATTTATTTATTGTAATTTGATTTATCATCAA[G/A]
TATTCTTTAAGCATGATTTAAATATTTTTATAACAAATAGTCAAACGTTTGTCAAAAAAAACCAATGACGTCATATATTAAAAAACGAAGGTAGTATGTC
GACATACTACCTTCGTTTTTTAATATATGACGTCATTGGTTTTTTTTGACAAACGTTTGACTATTTGTTATAAAAATATTTAAATCATGCTTAAAGAATA[C/T]
TTGATGATAAATCAAATTACAATAAATAAATGATAAGCATATAAAATTTTTTGAATAAAACGAATAGTTAAACGTATAAAAAAAATCAGCGATGTCATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 14.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 15.90% | 83.80% | 0.33% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 57.00% | 43.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.90% | 15.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 21.30% | 78.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 12.70% | 86.70% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701179040 | G -> A | LOC_Os07g03100.1 | upstream_gene_variant ; 1190.0bp to feature; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| vg0701179040 | G -> A | LOC_Os07g03100.3 | upstream_gene_variant ; 1205.0bp to feature; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| vg0701179040 | G -> A | LOC_Os07g03100.2 | upstream_gene_variant ; 1205.0bp to feature; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| vg0701179040 | G -> A | LOC_Os07g03090.1 | downstream_gene_variant ; 933.0bp to feature; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| vg0701179040 | G -> A | LOC_Os07g03110.1 | downstream_gene_variant ; 4240.0bp to feature; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| vg0701179040 | G -> A | LOC_Os07g03090-LOC_Os07g03100 | intergenic_region ; MODIFIER | silent_mutation | Average:30.75; most accessible tissue: Callus, score: 71.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701179040 | NA | 5.14E-09 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701179040 | NA | 1.76E-08 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701179040 | NA | 2.94E-08 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701179040 | NA | 2.41E-12 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701179040 | 1.21E-06 | 1.21E-06 | mr1651_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |