\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701179040:

Variant ID: vg0701179040 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1179040
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.15, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGACATCGCTGATTTTTTTTATACGTTTAACTATTCGTTTTATTCAAAAAATTTTATATGCTTATCATTTATTTATTGTAATTTGATTTATCATCAA[G/A]
TATTCTTTAAGCATGATTTAAATATTTTTATAACAAATAGTCAAACGTTTGTCAAAAAAAACCAATGACGTCATATATTAAAAAACGAAGGTAGTATGTC

Reverse complement sequence

GACATACTACCTTCGTTTTTTAATATATGACGTCATTGGTTTTTTTTGACAAACGTTTGACTATTTGTTATAAAAATATTTAAATCATGCTTAAAGAATA[C/T]
TTGATGATAAATCAAATTACAATAAATAAATGATAAGCATATAAAATTTTTTGAATAAAACGAATAGTTAAACGTATAAAAAAAATCAGCGATGTCATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.40% 0.15% 0.00% NA
All Indica  2759 85.60% 14.40% 0.04% 0.00% NA
All Japonica  1512 15.90% 83.80% 0.33% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 57.00% 43.00% 0.00% 0.00% NA
Indica III  913 93.30% 6.70% 0.00% 0.00% NA
Indica Intermediate  786 84.90% 15.00% 0.13% 0.00% NA
Temperate Japonica  767 21.30% 78.50% 0.26% 0.00% NA
Tropical Japonica  504 12.70% 86.70% 0.60% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701179040 G -> A LOC_Os07g03100.1 upstream_gene_variant ; 1190.0bp to feature; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N
vg0701179040 G -> A LOC_Os07g03100.3 upstream_gene_variant ; 1205.0bp to feature; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N
vg0701179040 G -> A LOC_Os07g03100.2 upstream_gene_variant ; 1205.0bp to feature; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N
vg0701179040 G -> A LOC_Os07g03090.1 downstream_gene_variant ; 933.0bp to feature; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N
vg0701179040 G -> A LOC_Os07g03110.1 downstream_gene_variant ; 4240.0bp to feature; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N
vg0701179040 G -> A LOC_Os07g03090-LOC_Os07g03100 intergenic_region ; MODIFIER silent_mutation Average:30.75; most accessible tissue: Callus, score: 71.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701179040 NA 5.14E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701179040 NA 1.76E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701179040 NA 2.94E-08 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701179040 NA 2.41E-12 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701179040 1.21E-06 1.21E-06 mr1651_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251