\
| Variant ID: vg0701084978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1084978 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGTCCCAGAATATAGAGAATTTTAGAGTTGGACAAGGTTATTAAGAAAGTAGATAGAATTAAATAGGAATGTGTTGTGATTGGTTAAGAAGTGGAGGTAG[A/G]
TGAGAAAAGTTAATGGTAGAGGGTTGTGATTGATTGGGAAGGAAATGTTGGTGAGGAAGTTGTTATATTTTAGGATAAATCTGAAGTGCTAAAAATTATT
AATAATTTTTAGCACTTCAGATTTATCCTAAAATATAACAACTTCCTCACCAACATTTCCTTCCCAATCAATCACAACCCTCTACCATTAACTTTTCTCA[T/C]
CTACCTCCACTTCTTAACCAATCACAACACATTCCTATTTAATTCTATCTACTTTCTTAATAACCTTGTCCAACTCTAAAATTCTCTATATTCTGGGACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.80% | 5.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.20% | 65.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701084978 | A -> G | LOC_Os07g02880.1 | upstream_gene_variant ; 3242.0bp to feature; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| vg0701084978 | A -> G | LOC_Os07g02890.1 | upstream_gene_variant ; 553.0bp to feature; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| vg0701084978 | A -> G | LOC_Os07g02900.1 | downstream_gene_variant ; 824.0bp to feature; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| vg0701084978 | A -> G | LOC_Os07g02910.1 | downstream_gene_variant ; 2410.0bp to feature; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| vg0701084978 | A -> G | LOC_Os07g02920.1 | downstream_gene_variant ; 4515.0bp to feature; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| vg0701084978 | A -> G | LOC_Os07g02890-LOC_Os07g02900 | intergenic_region ; MODIFIER | silent_mutation | Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701084978 | NA | 6.83E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 5.99E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 2.19E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 5.90E-09 | mr1320 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 1.99E-11 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 5.16E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 1.63E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 1.18E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 6.35E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701084978 | NA | 1.19E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |