\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701084978:

Variant ID: vg0701084978 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1084978
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCCAGAATATAGAGAATTTTAGAGTTGGACAAGGTTATTAAGAAAGTAGATAGAATTAAATAGGAATGTGTTGTGATTGGTTAAGAAGTGGAGGTAG[A/G]
TGAGAAAAGTTAATGGTAGAGGGTTGTGATTGATTGGGAAGGAAATGTTGGTGAGGAAGTTGTTATATTTTAGGATAAATCTGAAGTGCTAAAAATTATT

Reverse complement sequence

AATAATTTTTAGCACTTCAGATTTATCCTAAAATATAACAACTTCCTCACCAACATTTCCTTCCCAATCAATCACAACCCTCTACCATTAACTTTTCTCA[T/C]
CTACCTCCACTTCTTAACCAATCACAACACATTCCTATTTAATTCTATCTACTTTCTTAATAACCTTGTCCAACTCTAAAATTCTCTATATTCTGGGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.20% 0.02% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 34.20% 65.40% 0.37% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701084978 A -> G LOC_Os07g02880.1 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N
vg0701084978 A -> G LOC_Os07g02890.1 upstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N
vg0701084978 A -> G LOC_Os07g02900.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N
vg0701084978 A -> G LOC_Os07g02910.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N
vg0701084978 A -> G LOC_Os07g02920.1 downstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N
vg0701084978 A -> G LOC_Os07g02890-LOC_Os07g02900 intergenic_region ; MODIFIER silent_mutation Average:62.982; most accessible tissue: Minghui63 flower, score: 69.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701084978 NA 6.83E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 5.99E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 2.19E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 5.90E-09 mr1320 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 1.99E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 5.16E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 1.63E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 1.18E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 6.35E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701084978 NA 1.19E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251