\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701068994:

Variant ID: vg0701068994 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1068994
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAAATCAATTTAAATTTAAGGTTGAAAATTTAAATTTTGTCTAATAAATATAAGCATAAATGAAAAGATGAGACTAATATGCGTTACGTGAATAATAT[T/G]
CTACAAACGAGAAATGTGAATACTACATGACAGCCAATGCTCGCAAGCCAAGCCAACTCTGGCTTTGTTCATGGACGAGGCTTGGGCTTGACTCGTTTGC

Reverse complement sequence

GCAAACGAGTCAAGCCCAAGCCTCGTCCATGAACAAAGCCAGAGTTGGCTTGGCTTGCGAGCATTGGCTGTCATGTAGTATTCACATTTCTCGTTTGTAG[A/C]
ATATTATTCACGTAACGCATATTAGTCTCATCTTTTCATTTATGCTTATATTTATTAGACAAAATTTAAATTTTCAACCTTAAATTTAAATTGATTTTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 6.60% 1.57% 0.00% NA
All Indica  2759 91.50% 7.50% 0.94% 0.00% NA
All Japonica  1512 90.70% 6.30% 2.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 61.70% 33.50% 4.73% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.50% 0.25% 0.00% NA
Temperate Japonica  767 96.00% 0.00% 4.04% 0.00% NA
Tropical Japonica  504 80.00% 18.10% 1.98% 0.00% NA
Japonica Intermediate  241 96.70% 1.70% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701068994 T -> G LOC_Os07g02840.1 downstream_gene_variant ; 3284.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701068994 T -> G LOC_Os07g02850.1 downstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701068994 T -> G LOC_Os07g02860.1 downstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701068994 T -> G LOC_Os07g02850-LOC_Os07g02860 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701068994 NA 7.12E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.27E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 6.82E-09 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.74E-07 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 6.17E-07 2.61E-10 mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 5.21E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 2.52E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.64E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.28E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.17E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 2.70E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 1.29E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 2.69E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 2.10E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701068994 NA 7.60E-11 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251