\
| Variant ID: vg0701065951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1065951 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 96. )
TGACGTTTTGGACAAGATTGAGGTCAAACTTTTATAATTTGATCATCAATAACTTTAAAAATATTTAATTTAAAGGAACTAGAACAACATATATATATTT[A/G]
TATTTTAAAGCACTATAATAAAAGTAAACATGCATTTATTTATTATATATATTATAGTAGAAAAATAAGGTCAAAGATATATCTTGTAGACCATGTTATT
AATAACATGGTCTACAAGATATATCTTTGACCTTATTTTTCTACTATAATATATATAATAAATAAATGCATGTTTACTTTTATTATAGTGCTTTAAAATA[T/C]
AAATATATATATGTTGTTCTAGTTCCTTTAAATTAAATATTTTTAAAGTTATTGATGATCAAATTATAAAAGTTTGACCTCAATCTTGTCCAAAACGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.40% | 7.60% | 1.99% | 51.93% | NA |
| All Indica | 2759 | 10.90% | 6.40% | 2.39% | 80.25% | NA |
| All Japonica | 1512 | 94.90% | 1.90% | 0.40% | 2.78% | NA |
| Aus | 269 | 11.50% | 21.20% | 4.46% | 62.83% | NA |
| Indica I | 595 | 2.20% | 2.70% | 3.19% | 91.93% | NA |
| Indica II | 465 | 43.40% | 1.50% | 0.86% | 54.19% | NA |
| Indica III | 913 | 1.80% | 8.80% | 1.64% | 87.84% | NA |
| Indica Intermediate | 786 | 9.00% | 9.40% | 3.56% | 77.99% | NA |
| Temperate Japonica | 767 | 98.40% | 0.10% | 0.26% | 1.17% | NA |
| Tropical Japonica | 504 | 89.50% | 3.80% | 0.60% | 6.15% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.70% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 1.00% | 87.50% | 5.21% | 6.25% | NA |
| Intermediate | 90 | 53.30% | 15.60% | 5.56% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701065951 | A -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701065951 | A -> G | LOC_Os07g02820.1 | upstream_gene_variant ; 3543.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701065951 | A -> G | LOC_Os07g02850.1 | upstream_gene_variant ; 1067.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701065951 | A -> G | LOC_Os07g02840.1 | downstream_gene_variant ; 241.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701065951 | A -> G | LOC_Os07g02860.1 | downstream_gene_variant ; 3363.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701065951 | A -> G | LOC_Os07g02840-LOC_Os07g02850 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701065951 | NA | 4.04E-07 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701065951 | 1.18E-06 | 1.18E-06 | mr1572 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701065951 | NA | 2.78E-07 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701065951 | NA | 2.69E-07 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |