Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701065951:

Variant ID: vg0701065951 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1065951
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TGACGTTTTGGACAAGATTGAGGTCAAACTTTTATAATTTGATCATCAATAACTTTAAAAATATTTAATTTAAAGGAACTAGAACAACATATATATATTT[A/G]
TATTTTAAAGCACTATAATAAAAGTAAACATGCATTTATTTATTATATATATTATAGTAGAAAAATAAGGTCAAAGATATATCTTGTAGACCATGTTATT

Reverse complement sequence

AATAACATGGTCTACAAGATATATCTTTGACCTTATTTTTCTACTATAATATATATAATAAATAAATGCATGTTTACTTTTATTATAGTGCTTTAAAATA[T/C]
AAATATATATATGTTGTTCTAGTTCCTTTAAATTAAATATTTTTAAAGTTATTGATGATCAAATTATAAAAGTTTGACCTCAATCTTGTCCAAAACGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.40%	7.60%	1.99%	51.93%	NA
All Indica	2759	10.90%	6.40%	2.39%	80.25%	NA
All Japonica	1512	94.90%	1.90%	0.40%	2.78%	NA
Aus	269	11.50%	21.20%	4.46%	62.83%	NA
Indica I	595	2.20%	2.70%	3.19%	91.93%	NA
Indica II	465	43.40%	1.50%	0.86%	54.19%	NA
Indica III	913	1.80%	8.80%	1.64%	87.84%	NA
Indica Intermediate	786	9.00%	9.40%	3.56%	77.99%	NA
Temperate Japonica	767	98.40%	0.10%	0.26%	1.17%	NA
Tropical Japonica	504	89.50%	3.80%	0.60%	6.15%	NA
Japonica Intermediate	241	95.00%	3.70%	0.41%	0.83%	NA
VI/Aromatic	96	1.00%	87.50%	5.21%	6.25%	NA
Intermediate	90	53.30%	15.60%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701065951	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701065951	A -> G	LOC_Os07g02820.1	upstream_gene_variant ; 3543.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701065951	A -> G	LOC_Os07g02850.1	upstream_gene_variant ; 1067.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701065951	A -> G	LOC_Os07g02840.1	downstream_gene_variant ; 241.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701065951	A -> G	LOC_Os07g02860.1	downstream_gene_variant ; 3363.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701065951	A -> G	LOC_Os07g02840-LOC_Os07g02850	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701065951	NA	4.04E-07	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701065951	1.18E-06	1.18E-06	mr1572	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701065951	NA	2.78E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701065951	NA	2.69E-07	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251