Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700974440:

Variant ID: vg0700974440 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 974440
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

CATGTATGGATAAAATGCTGAATTTTACTTGGAATTCGCAAGCATCAGCAAGCGACCAATCCTCACAAGTCACAACCCCAACACCGCGACGTGTTTCAGT[A/T]
AAATCTTATACTACTGGGTGAGTGGCAGATATTATACAGTTTCAGCCCTTACTGTAGGCAACTTGAAATTCAGACTTACAAGTCAAGCAACAAAGTGATG

Reverse complement sequence

CATCACTTTGTTGCTTGACTTGTAAGTCTGAATTTCAAGTTGCCTACAGTAAGGGCTGAAACTGTATAATATCTGCCACTCACCCAGTAGTATAAGATTT[T/A]
ACTGAAACACGTCGCGGTGTTGGGGTTGTGACTTGTGAGGATTGGTCGCTTGCTGATGCTTGCGAATTCCAAGTAAAATTCAGCATTTTATCCATACATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	37.40%	0.08%	0.00%	NA
All Indica	2759	90.00%	9.90%	0.07%	0.00%	NA
All Japonica	1512	5.20%	94.80%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	57.60%	42.20%	0.22%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	91.50%	8.40%	0.13%	0.00%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	9.30%	90.70%	0.00%	0.00%	NA
Japonica Intermediate	241	6.20%	93.80%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	44.40%	53.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700974440	A -> T	LOC_Os07g02674.1	upstream_gene_variant ; 4040.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700974440	A -> T	LOC_Os07g02700.1	upstream_gene_variant ; 1881.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700974440	A -> T	LOC_Os07g02710.1	upstream_gene_variant ; 4002.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700974440	A -> T	LOC_Os07g02690.1	downstream_gene_variant ; 906.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700974440	A -> T	LOC_Os07g02690-LOC_Os07g02700	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700974440	NA	8.33E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	4.04E-11	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	2.55E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.82E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	4.77E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	7.07E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	7.25E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.98E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	2.68E-06	1.04E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	7.59E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.03E-14	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	6.10E-09	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	5.33E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	8.16E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	3.12E-18	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	8.73E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	7.19E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.70E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	7.06E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	3.21E-09	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	4.18E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	4.87E-10	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	3.96E-06	1.59E-07	mr1402_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	3.55E-09	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	6.77E-07	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.29E-07	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	5.51E-18	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	2.02E-08	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	1.21E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700974440	NA	2.52E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251