Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700923552:

Variant ID: vg0700923552 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 923552
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTACGACGGGTGGTTAATTATCTCCATATCAATCTAAATCATTCTAGAGGCTAATTTTGATATCTAAATCAGCTCCGCTAGCCGGTTTAGTTTTACAAAA[C/T]
CCATCATGGTTTAGCTTCGTCTAAATCGAGGTGGTTTGTAAATCCATATCACCGCAAGACGTTTAAGTGTCCTATTCGTGATTGTCTTCTTGTAAAAAAA

Reverse complement sequence

TTTTTTTACAAGAAGACAATCACGAATAGGACACTTAAACGTCTTGCGGTGATATGGATTTACAAACCACCTCGATTTAGACGAAGCTAAACCATGATGG[G/A]
TTTTGTAAAACTAAACCGGCTAGCGGAGCTGATTTAGATATCAAAATTAGCCTCTAGAATGATTTAGATTGATATGGAGATAATTAACCACCCGTCGTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	6.40%	0.85%	0.04%	NA
All Indica	2759	91.60%	7.60%	0.72%	0.00%	NA
All Japonica	1512	93.60%	5.40%	0.99%	0.00%	NA
Aus	269	98.10%	0.00%	1.12%	0.74%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	63.40%	32.90%	3.66%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	92.40%	7.30%	0.38%	0.00%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	82.50%	15.70%	1.79%	0.00%	NA
Japonica Intermediate	241	97.50%	1.20%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700923552	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02550.1	upstream_gene_variant ; 4242.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02560.1	upstream_gene_variant ; 2074.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02570.1	downstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02580.1	downstream_gene_variant ; 4310.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02590.1	downstream_gene_variant ; 4943.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02590.2	downstream_gene_variant ; 4988.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700923552	C -> T	LOC_Os07g02560-LOC_Os07g02570	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700923552	3.07E-06	2.51E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	3.12E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	1.91E-07	1.18E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	1.65E-11	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	8.30E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	3.95E-09	1.65E-09	mr1226	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	7.31E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	6.20E-10	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	7.89E-08	7.89E-08	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	4.44E-06	3.83E-09	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	3.44E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	2.10E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	7.40E-07	2.51E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	1.16E-06	2.44E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	6.26E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	3.94E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	4.84E-10	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	4.78E-07	5.89E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	2.20E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700923552	NA	2.07E-11	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251