| Variant ID: vg0700863821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 863821 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATTTTGATATAATCTTTTAAAGCAACTTTTCTATAAAAACTTTTTAATAAAACGTATCGTTTAACAGTTTAGGAAACATGCGTGTGAAAAACGAGGCA[G/T]
ATATATATAAGTTGGGGACTTAGAATACAACTTTTAAGAGCAAGTCTAATAAGCAAACGATTAGCCCGTATATGTTGTCTCGATCTAACGTGGAAGAGAG
CTCTCTTCCACGTTAGATCGAGACAACATATACGGGCTAATCGTTTGCTTATTAGACTTGCTCTTAAAAGTTGTATTCTAAGTCCCCAACTTATATATAT[C/A]
TGCCTCGTTTTTCACACGCATGTTTCCTAAACTGTTAAACGATACGTTTTATTAAAAAGTTTTTATAGAAAAGTTGCTTTAAAAGATTATATCAAAATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 2.80% | 0.72% | 34.17% | NA |
| All Indica | 2759 | 42.30% | 0.00% | 1.23% | 56.51% | NA |
| All Japonica | 1512 | 90.00% | 8.70% | 0.00% | 1.26% | NA |
| Aus | 269 | 92.20% | 0.00% | 0.00% | 7.81% | NA |
| Indica I | 595 | 21.50% | 0.00% | 1.51% | 76.97% | NA |
| Indica II | 465 | 86.90% | 0.00% | 0.43% | 12.69% | NA |
| Indica III | 913 | 27.80% | 0.00% | 1.42% | 70.76% | NA |
| Indica Intermediate | 786 | 48.30% | 0.00% | 1.27% | 50.38% | NA |
| Temperate Japonica | 767 | 97.00% | 2.00% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 92.70% | 5.40% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 62.20% | 37.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 84.40% | 2.20% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700863821 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700863821 | G -> T | LOC_Os07g02480.1 | upstream_gene_variant ; 3926.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700863821 | G -> T | LOC_Os07g02490.1 | downstream_gene_variant ; 1222.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700863821 | G -> T | LOC_Os07g02480-LOC_Os07g02490 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700863821 | NA | 8.33E-06 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 5.71E-07 | 1.26E-08 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 7.97E-08 | 1.79E-11 | mr1114 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 4.60E-06 | 1.21E-07 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 4.07E-07 | 2.87E-12 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 3.50E-06 | 2.66E-11 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | NA | 2.67E-08 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 1.40E-06 | 6.52E-09 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 2.94E-08 | 8.53E-12 | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700863821 | 2.01E-06 | 3.26E-09 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/