Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700622597:

Variant ID: vg0700622597 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 622597
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAAATACATAATCCCTCTACACCAGCAGCATGCAGTCCTCCAGACCAGGAGAGCACCGGCTCCGTCTCCCTCCAGCCGGGCAAGAACAAGGAGAGG[C/T]
GAGAGAAAGACGGAGAGCAGCAATAGCAAAAACAAAGCAGCAAAATTCTAGGGAGAGAGCTACAAATCGGACGTCCGATGTTGAAAAAAAATCGGATGGT

Reverse complement sequence

ACCATCCGATTTTTTTTCAACATCGGACGTCCGATTTGTAGCTCTCTCCCTAGAATTTTGCTGCTTTGTTTTTGCTATTGCTGCTCTCCGTCTTTCTCTC[G/A]
CCTCTCCTTGTTCTTGCCCGGCTGGAGGGAGACGGAGCCGGTGCTCTCCTGGTCTGGAGGACTGCATGCTGCTGGTGTAGAGGGATTATGTATTTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.60% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700622597 C -> T LOC_Os07g02030.1 downstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700622597 C -> T LOC_Os07g02040.1 downstream_gene_variant ; 876.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700622597 C -> T LOC_Os07g02030-LOC_Os07g02040 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700622597 NA 1.29E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 2.47E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 1.49E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 2.97E-06 NA mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 4.72E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 1.25E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 8.24E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 4.53E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 9.32E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 7.68E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 8.75E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 5.29E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 3.95E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700622597 NA 6.41E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251