| Variant ID: vg0700534651 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 534651 |
| Reference Allele: A | Alternative Allele: T,AT,ATT |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, T: 0.12, others allele: 0.00, population size: 112. )
GGGTTCCATTTTTTTTTATTTTTCCTTTCTCTTCTTCAGGTTACTATCGGGCCAAGCGCATTCGTGTTTAAAAAAGTTTTTTTAGAAAAAACAAAATCAA[A/T,AT,ATT]
TTTTTTAAAAAAAATACAATATAAATGCATACACTCATATAAACATACGCGCACATGCAAGTACCCGAGTGGATAGGTTACACAGCAAGAACCTATTTAG
CTAAATAGGTTCTTGCTGTGTAACCTATCCACTCGGGTACTTGCATGTGCGCGTATGTTTATATGAGTGTATGCATTTATATTGTATTTTTTTTAAAAAA[T/A,AT,AAT]
TTGATTTTGTTTTTTCTAAAAAAACTTTTTTAAACACGAATGCGCTTGGCCCGATAGTAACCTGAAGAAGAGAAAGGAAAAATAAAAAAAAATGGAACCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 46.90% | 0.21% | 0.00% | AT: 1.59%; ATT: 0.08% |
| All Indica | 2759 | 78.90% | 18.10% | 0.33% | 0.00% | AT: 2.65%; ATT: 0.04% |
| All Japonica | 1512 | 0.60% | 99.30% | 0.00% | 0.00% | AT: 0.13% |
| Aus | 269 | 72.90% | 26.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.00% | 0.50% | 0.00% | AT: 0.67% |
| Indica II | 465 | 39.80% | 59.10% | 0.43% | 0.00% | AT: 0.65% |
| Indica III | 913 | 84.40% | 8.70% | 0.00% | 0.00% | AT: 6.90% |
| Indica Intermediate | 786 | 81.90% | 17.00% | 0.51% | 0.00% | AT: 0.38%; ATT: 0.13% |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.40% | 0.00% | 0.00% | AT: 0.40% |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 63.30% | 0.00% | 0.00% | ATT: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700534651 | A -> AT | LOC_Os07g01880.1 | upstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> AT | LOC_Os07g01900.1 | upstream_gene_variant ; 3329.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> AT | LOC_Os07g01890.1 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> AT | LOC_Os07g01890.2 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> AT | LOC_Os07g01880-LOC_Os07g01890 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> ATT | LOC_Os07g01880.1 | upstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> ATT | LOC_Os07g01900.1 | upstream_gene_variant ; 3329.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> ATT | LOC_Os07g01890.1 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> ATT | LOC_Os07g01890.2 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> ATT | LOC_Os07g01880-LOC_Os07g01890 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> T | LOC_Os07g01880.1 | upstream_gene_variant ; 308.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> T | LOC_Os07g01900.1 | upstream_gene_variant ; 3330.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> T | LOC_Os07g01890.1 | downstream_gene_variant ; 951.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> T | LOC_Os07g01890.2 | downstream_gene_variant ; 951.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700534651 | A -> T | LOC_Os07g01880-LOC_Os07g01890 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700534651 | NA | 1.32E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 1.16E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 3.50E-09 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 1.06E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 2.17E-14 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 5.28E-10 | mr1680 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 3.01E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 3.86E-11 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 1.37E-14 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 1.23E-10 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 3.40E-10 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700534651 | NA | 2.56E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |